Incidental Mutation 'R0898:Ddx59'
ID83738
Institutional Source Beutler Lab
Gene Symbol Ddx59
Ensembl Gene ENSMUSG00000026404
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Synonyms
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0898 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136415271-136440158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136416941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 117 (Y117H)
Ref Sequence ENSEMBL: ENSMUSP00000027655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027655]
Predicted Effect probably damaging
Transcript: ENSMUST00000027655
AA Change: Y117H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027655
Gene: ENSMUSG00000026404
AA Change: Y117H

DomainStartEndE-ValueType
Pfam:zf-HIT 104 133 5.5e-11 PFAM
DEXDc 222 420 5.43e-55 SMART
HELICc 458 540 1.79e-23 SMART
low complexity region 583 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194227
Meta Mutation Damage Score 0.6969 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Iqck G A 7: 118,971,441 C272Y probably damaging Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Nabp1 T C 1: 51,471,337 I169V probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc1a4 T C 11: 20,304,349 T506A probably damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Sox11 T C 12: 27,341,225 Y395C probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Tpgs2 G A 18: 25,149,150 P115S probably damaging Het
Trmt10a C T 3: 138,149,518 P139L probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Ddx59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Ddx59 APN 1 136433827 missense probably damaging 0.99
IGL02191:Ddx59 APN 1 136417158 missense probably damaging 1.00
IGL02525:Ddx59 APN 1 136417005 missense probably benign 0.03
IGL02712:Ddx59 APN 1 136439781 missense probably benign 0.14
R0219:Ddx59 UTSW 1 136432309 splice site probably benign
R1728:Ddx59 UTSW 1 136417053 missense probably benign
R1729:Ddx59 UTSW 1 136417053 missense probably benign
R1730:Ddx59 UTSW 1 136417053 missense probably benign
R1739:Ddx59 UTSW 1 136417053 missense probably benign
R1762:Ddx59 UTSW 1 136417053 missense probably benign
R1783:Ddx59 UTSW 1 136417053 missense probably benign
R1784:Ddx59 UTSW 1 136417053 missense probably benign
R1785:Ddx59 UTSW 1 136417053 missense probably benign
R1817:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1818:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1819:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R2091:Ddx59 UTSW 1 136416709 missense probably benign
R3922:Ddx59 UTSW 1 136416744 missense probably benign
R3923:Ddx59 UTSW 1 136416744 missense probably benign
R3926:Ddx59 UTSW 1 136416744 missense probably benign
R3945:Ddx59 UTSW 1 136434618 missense probably damaging 0.99
R4182:Ddx59 UTSW 1 136439861 missense probably benign 0.01
R4589:Ddx59 UTSW 1 136439742 splice site probably null
R4636:Ddx59 UTSW 1 136432563 missense probably damaging 0.96
R4721:Ddx59 UTSW 1 136417106 missense probably benign 0.00
R5276:Ddx59 UTSW 1 136419448 missense probably damaging 1.00
R6318:Ddx59 UTSW 1 136416872 missense probably damaging 0.99
R7602:Ddx59 UTSW 1 136433821 missense probably benign 0.01
Z1088:Ddx59 UTSW 1 136432451 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCACCAACAGTCCTTCTTGCC -3'
(R):5'- GCCACAGTGCTCGAAGTCGATAATG -3'

Sequencing Primer
(F):5'- TCTTCCACAGGACCTGATGA -3'
(R):5'- TGAACTGAGATTCCTAGCTGC -3'
Posted On2013-11-08