Incidental Mutation 'R0898:Fmn2'
ID 83739
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Name formin 2
Synonyms
MMRRC Submission 039058-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.824) question?
Stock # R0898 (G1)
Quality Score 209
Status Validated
Chromosome 1
Chromosomal Location 174329391-174650295 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 174331026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 472 (G472E)
Ref Sequence ENSEMBL: ENSMUSP00000030039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
AlphaFold Q9JL04
Predicted Effect unknown
Transcript: ENSMUST00000030039
AA Change: G472E
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354
AA Change: G472E

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,351,814 (GRCm39) probably null Het
Apmap A G 2: 150,427,669 (GRCm39) probably benign Het
Arhgap11a T C 2: 113,667,221 (GRCm39) N442S probably benign Het
Bpifb5 C T 2: 154,075,254 (GRCm39) A394V probably benign Het
Brpf3 A G 17: 29,025,964 (GRCm39) T346A possibly damaging Het
Ccdc154 A G 17: 25,383,055 (GRCm39) probably benign Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Col3a1 T C 1: 45,373,153 (GRCm39) probably benign Het
Cpm A C 10: 117,512,011 (GRCm39) probably benign Het
Crlf2 G C 5: 109,705,004 (GRCm39) P67R probably damaging Het
Ddx59 T C 1: 136,344,679 (GRCm39) Y117H probably damaging Het
Fam241b A G 10: 61,944,773 (GRCm39) F98L probably damaging Het
Gcdh T C 8: 85,620,189 (GRCm39) H41R possibly damaging Het
Gm7713 A C 15: 59,866,290 (GRCm39) noncoding transcript Het
Gmeb1 T C 4: 131,962,093 (GRCm39) T189A probably benign Het
Iqck G A 7: 118,570,664 (GRCm39) C272Y probably damaging Het
Kcnn2 T C 18: 45,692,543 (GRCm39) C40R possibly damaging Het
Map3k1 T C 13: 111,904,490 (GRCm39) probably benign Het
Nabp1 T C 1: 51,510,496 (GRCm39) I169V probably benign Het
Or14j8 T C 17: 38,263,127 (GRCm39) T263A probably benign Het
Or8c20 G A 9: 38,260,738 (GRCm39) V120M probably damaging Het
Pfkm A G 15: 98,026,111 (GRCm39) I569V probably benign Het
Plcb1 A T 2: 135,229,063 (GRCm39) T1096S possibly damaging Het
Plscr4 A C 9: 92,366,806 (GRCm39) D140A probably damaging Het
Plxna2 A G 1: 194,479,332 (GRCm39) D1331G probably damaging Het
Ppfia4 T C 1: 134,248,864 (GRCm39) T498A probably benign Het
Prkar2b A T 12: 32,013,001 (GRCm39) L372I possibly damaging Het
Rslcan18 T C 13: 67,246,880 (GRCm39) N120S probably benign Het
Sbf2 C T 7: 109,970,859 (GRCm39) V846I possibly damaging Het
Slc16a7 A G 10: 125,069,370 (GRCm39) I102T possibly damaging Het
Slc1a4 T C 11: 20,254,349 (GRCm39) T506A probably damaging Het
Slc22a7 T C 17: 46,744,075 (GRCm39) T462A probably damaging Het
Sox11 T C 12: 27,391,224 (GRCm39) Y395C probably damaging Het
Taf2 T C 15: 54,923,480 (GRCm39) T266A probably damaging Het
Tanc1 C T 2: 59,621,132 (GRCm39) T317I probably damaging Het
Tnxb T C 17: 34,889,719 (GRCm39) S71P probably damaging Het
Tpgs2 G A 18: 25,282,207 (GRCm39) P115S probably damaging Het
Trmt10a C T 3: 137,855,279 (GRCm39) P139L probably damaging Het
Zfp113 T C 5: 138,143,051 (GRCm39) S400G probably benign Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174,330,885 (GRCm39) missense unknown
IGL01085:Fmn2 APN 1 174,523,220 (GRCm39) missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174,329,994 (GRCm39) missense unknown
IGL02095:Fmn2 APN 1 174,330,167 (GRCm39) missense unknown
IGL02330:Fmn2 APN 1 174,437,511 (GRCm39) missense probably benign 0.38
IGL02552:Fmn2 APN 1 174,523,286 (GRCm39) missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174,409,625 (GRCm39) missense unknown
PIT4498001:Fmn2 UTSW 1 174,440,170 (GRCm39) missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174,474,699 (GRCm39) missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174,618,880 (GRCm39) missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0062:Fmn2 UTSW 1 174,436,015 (GRCm39) unclassified probably benign
R0306:Fmn2 UTSW 1 174,437,050 (GRCm39) unclassified probably benign
R0325:Fmn2 UTSW 1 174,437,520 (GRCm39) critical splice donor site probably null
R0403:Fmn2 UTSW 1 174,521,844 (GRCm39) missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174,409,525 (GRCm39) missense unknown
R1202:Fmn2 UTSW 1 174,440,101 (GRCm39) nonsense probably null
R1719:Fmn2 UTSW 1 174,436,024 (GRCm39) unclassified probably benign
R1763:Fmn2 UTSW 1 174,329,832 (GRCm39) missense unknown
R1771:Fmn2 UTSW 1 174,436,342 (GRCm39) unclassified probably benign
R1777:Fmn2 UTSW 1 174,409,488 (GRCm39) missense unknown
R1831:Fmn2 UTSW 1 174,437,511 (GRCm39) missense probably benign 0.38
R2259:Fmn2 UTSW 1 174,330,498 (GRCm39) missense unknown
R2960:Fmn2 UTSW 1 174,437,385 (GRCm39) missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174,330,192 (GRCm39) missense unknown
R3840:Fmn2 UTSW 1 174,409,599 (GRCm39) frame shift probably null
R4207:Fmn2 UTSW 1 174,409,521 (GRCm39) missense unknown
R4679:Fmn2 UTSW 1 174,330,728 (GRCm39) missense unknown
R4779:Fmn2 UTSW 1 174,437,461 (GRCm39) missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174,409,527 (GRCm39) missense unknown
R4926:Fmn2 UTSW 1 174,329,981 (GRCm39) missense unknown
R5007:Fmn2 UTSW 1 174,571,866 (GRCm39) missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174,648,794 (GRCm39) missense probably benign 0.04
R5324:Fmn2 UTSW 1 174,436,446 (GRCm39) unclassified probably benign
R5353:Fmn2 UTSW 1 174,330,572 (GRCm39) missense unknown
R5420:Fmn2 UTSW 1 174,526,344 (GRCm39) nonsense probably null
R5607:Fmn2 UTSW 1 174,437,377 (GRCm39) missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174,409,603 (GRCm39) missense unknown
R5982:Fmn2 UTSW 1 174,330,019 (GRCm39) missense unknown
R6148:Fmn2 UTSW 1 174,494,229 (GRCm39) missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174,440,119 (GRCm39) missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174,437,149 (GRCm39) unclassified probably benign
R6647:Fmn2 UTSW 1 174,420,670 (GRCm39) missense unknown
R6835:Fmn2 UTSW 1 174,527,235 (GRCm39) missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7340:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7378:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7457:Fmn2 UTSW 1 174,331,303 (GRCm39) splice site probably null
R7474:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R7564:Fmn2 UTSW 1 174,437,140 (GRCm39) missense unknown
R7582:Fmn2 UTSW 1 174,526,356 (GRCm39) missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174,494,215 (GRCm39) missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8035:Fmn2 UTSW 1 174,547,437 (GRCm39) missense probably damaging 1.00
R8203:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8343:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8371:Fmn2 UTSW 1 174,437,173 (GRCm39) missense unknown
R8377:Fmn2 UTSW 1 174,436,011 (GRCm39) nonsense probably null
R8543:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8724:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R8726:Fmn2 UTSW 1 174,437,404 (GRCm39) missense possibly damaging 0.86
R8891:Fmn2 UTSW 1 174,436,769 (GRCm39) unclassified probably benign
R9074:Fmn2 UTSW 1 174,436,198 (GRCm39) missense unknown
R9167:Fmn2 UTSW 1 174,331,056 (GRCm39) missense unknown
R9489:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9598:Fmn2 UTSW 1 174,436,308 (GRCm39) missense unknown
R9605:Fmn2 UTSW 1 174,436,194 (GRCm39) nonsense probably null
R9698:Fmn2 UTSW 1 174,364,739 (GRCm39) missense unknown
RF010:Fmn2 UTSW 1 174,409,581 (GRCm39) missense unknown
Z1176:Fmn2 UTSW 1 174,435,960 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GAGAATCCATTACCTCCGCAGTCG -3'
(R):5'- GAGACACCCCTGGCGGTAAATAAC -3'

Sequencing Primer
(F):5'- TTTGCCTGGAAGCCCTG -3'
(R):5'- CTGGGCCTTTCAGAACGTG -3'
Posted On 2013-11-08