Incidental Mutation 'R0898:Trmt10a'
ID83746
Institutional Source Beutler Lab
Gene Symbol Trmt10a
Ensembl Gene ENSMUSG00000004127
Gene NametRNA methyltransferase 10A
Synonyms3110023L08Rik, Rg9mtd2
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0898 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138143448-138159821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138149518 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 139 (P139L)
Ref Sequence ENSEMBL: ENSMUSP00000125749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040321] [ENSMUST00000159481] [ENSMUST00000159622] [ENSMUST00000161141] [ENSMUST00000162864]
Predicted Effect probably damaging
Transcript: ENSMUST00000040321
AA Change: P139L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042082
Gene: ENSMUSG00000004127
AA Change: P139L

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 277 3.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159481
SMART Domains Protein: ENSMUSP00000124465
Gene: ENSMUSG00000004127

DomainStartEndE-ValueType
coiled coil region 44 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159622
SMART Domains Protein: ENSMUSP00000130478
Gene: ENSMUSG00000004127

DomainStartEndE-ValueType
low complexity region 44 67 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161141
AA Change: P139L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125681
Gene: ENSMUSG00000004127
AA Change: P139L

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 165 2.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161791
Predicted Effect probably damaging
Transcript: ENSMUST00000162864
AA Change: P139L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125749
Gene: ENSMUSG00000004127
AA Change: P139L

DomainStartEndE-ValueType
low complexity region 44 82 N/A INTRINSIC
Pfam:tRNA_m1G_MT 111 277 2.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197680
Meta Mutation Damage Score 0.8954 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the tRNA (Guanine-1)-methyltransferase family. A similar gene in yeast modifies several different tRNA species. Mutations in this gene are associated with microcephaly, short stature, and impaired glucose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating magnesium level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Ddx59 T C 1: 136,416,941 Y117H probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Iqck G A 7: 118,971,441 C272Y probably damaging Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Nabp1 T C 1: 51,471,337 I169V probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc1a4 T C 11: 20,304,349 T506A probably damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Sox11 T C 12: 27,341,225 Y395C probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Tpgs2 G A 18: 25,149,150 P115S probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Trmt10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Trmt10a APN 3 138147416 missense probably damaging 0.97
IGL00563:Trmt10a APN 3 138147416 missense probably damaging 0.97
IGL00771:Trmt10a APN 3 138150455 missense probably benign 0.08
IGL01140:Trmt10a APN 3 138156698 splice site probably benign
IGL02869:Trmt10a APN 3 138152184 splice site probably null
R0975:Trmt10a UTSW 3 138156809 missense probably benign 0.41
R1511:Trmt10a UTSW 3 138152184 splice site probably null
R1872:Trmt10a UTSW 3 138156720 missense probably damaging 1.00
R4856:Trmt10a UTSW 3 138148385 nonsense probably null
R4880:Trmt10a UTSW 3 138152211 missense possibly damaging 0.64
R4886:Trmt10a UTSW 3 138148385 nonsense probably null
R5399:Trmt10a UTSW 3 138147504 missense probably damaging 0.97
R5516:Trmt10a UTSW 3 138152196 missense possibly damaging 0.91
R5994:Trmt10a UTSW 3 138156714 missense probably damaging 1.00
R7272:Trmt10a UTSW 3 138154766 missense probably damaging 1.00
X0028:Trmt10a UTSW 3 138154795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGACTTTTGCCTGCCTGACCATC -3'
(R):5'- TAAACCAGACACGTCTAAGAGGGCCTG -3'

Sequencing Primer
(F):5'- GCCTGACCATCTCTTCTGC -3'
(R):5'- TTCCCACAGTGGAAGGAGTC -3'
Posted On2013-11-08