Incidental Mutation 'R0898:Crlf2'
ID83748
Institutional Source Beutler Lab
Gene Symbol Crlf2
Ensembl Gene ENSMUSG00000033467
Gene Namecytokine receptor-like factor 2
SynonymsLy114, Tpte2, Tslpr
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R0898 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109554709-109558993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 109557138 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 67 (P67R)
Ref Sequence ENSEMBL: ENSMUSP00000143641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044579] [ENSMUST00000198960] [ENSMUST00000200284]
Predicted Effect probably damaging
Transcript: ENSMUST00000044579
AA Change: P69R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036326
Gene: ENSMUSG00000033467
AA Change: P69R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 84 102 N/A INTRINSIC
FN3 117 196 2.58e-4 SMART
low complexity region 210 253 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196881
Predicted Effect probably benign
Transcript: ENSMUST00000198960
SMART Domains Protein: ENSMUSP00000142982
Gene: ENSMUSG00000033467

DomainStartEndE-ValueType
Blast:FN3 1 52 2e-30 BLAST
SCOP:d1eerb2 1 65 7e-8 SMART
PDB:4NN7|C 1 66 2e-41 PDB
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200284
AA Change: P67R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143641
Gene: ENSMUSG00000033467
AA Change: P67R

DomainStartEndE-ValueType
low complexity region 82 100 N/A INTRINSIC
FN3 115 194 1.3e-6 SMART
low complexity region 208 251 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are overtly normal and maintain normal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Ddx59 T C 1: 136,416,941 Y117H probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Iqck G A 7: 118,971,441 C272Y probably damaging Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Nabp1 T C 1: 51,471,337 I169V probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc1a4 T C 11: 20,304,349 T506A probably damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Sox11 T C 12: 27,341,225 Y395C probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Tpgs2 G A 18: 25,149,150 P115S probably damaging Het
Trmt10a C T 3: 138,149,518 P139L probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Crlf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Crlf2 APN 5 109557570 missense possibly damaging 0.66
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0732:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R1277:Crlf2 UTSW 5 109557600 missense possibly damaging 0.46
R1674:Crlf2 UTSW 5 109558803 critical splice donor site probably null
R1912:Crlf2 UTSW 5 109557141 missense possibly damaging 0.83
R5276:Crlf2 UTSW 5 109557635 unclassified probably benign
R5418:Crlf2 UTSW 5 109557033 missense probably benign 0.05
R5984:Crlf2 UTSW 5 109555603 missense probably damaging 1.00
R6848:Crlf2 UTSW 5 109557031 missense possibly damaging 0.66
R7437:Crlf2 UTSW 5 109554973 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTGACATCATCAGAGCACTGCC -3'
(R):5'- GGTCTGTGACTTCCTGTCGGAATC -3'

Sequencing Primer
(F):5'- ATCAGGCAACTTCCTGCG -3'
(R):5'- GGGACGGTACTTCCTTTCAGAC -3'
Posted On2013-11-08