Incidental Mutation 'R0898:Iqck'
ID 83751
Institutional Source Beutler Lab
Gene Symbol Iqck
Ensembl Gene ENSMUSG00000073856
Gene Name IQ motif containing K
Synonyms
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0898 (G1)
Quality Score 176
Status Validated
Chromosome 7
Chromosomal Location 118855752-118972652 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118971441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 272 (C272Y)
Ref Sequence ENSEMBL: ENSMUSP00000102157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008878] [ENSMUST00000098087] [ENSMUST00000106547] [ENSMUST00000152136] [ENSMUST00000208394]
AlphaFold D3YYL3
Predicted Effect probably benign
Transcript: ENSMUST00000008878
SMART Domains Protein: ENSMUSP00000008878
Gene: ENSMUSG00000008734

DomainStartEndE-ValueType
Pfam:7tm_3 67 294 2e-33 PFAM
low complexity region 360 371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098087
AA Change: C275Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095693
Gene: ENSMUSG00000073856
AA Change: C275Y

DomainStartEndE-ValueType
low complexity region 111 120 N/A INTRINSIC
IQ 219 241 7.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106547
AA Change: C272Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102157
Gene: ENSMUSG00000073856
AA Change: C272Y

DomainStartEndE-ValueType
low complexity region 108 117 N/A INTRINSIC
IQ 216 238 7.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132148
Predicted Effect probably benign
Transcript: ENSMUST00000152136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208287
Predicted Effect probably benign
Transcript: ENSMUST00000208394
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the IQ motif-containing family of proteins. The IQ motif serves as a binding site for different EF-hand proteins such as calmodulin. This gene was identified as a potential candidate gene for obsessive-compulsive disorder in a genome-wide association study. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Ddx59 T C 1: 136,416,941 Y117H probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Nabp1 T C 1: 51,471,337 I169V probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc1a4 T C 11: 20,304,349 T506A probably damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Sox11 T C 12: 27,341,225 Y395C probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Tpgs2 G A 18: 25,149,150 P115S probably damaging Het
Trmt10a C T 3: 138,149,518 P139L probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Iqck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Iqck APN 7 118877678 missense probably damaging 1.00
IGL02810:Iqck APN 7 118971439 missense possibly damaging 0.94
IGL03403:Iqck APN 7 118876271 missense probably benign 0.21
R0541:Iqck UTSW 7 118915594 missense probably damaging 1.00
R0781:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R0829:Iqck UTSW 7 118899888 critical splice donor site probably null
R2273:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2274:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2275:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2509:Iqck UTSW 7 118876282 missense probably benign
R4033:Iqck UTSW 7 118941604 missense probably damaging 1.00
R6299:Iqck UTSW 7 118876262 missense unknown
R6520:Iqck UTSW 7 118941631 missense probably damaging 1.00
R7095:Iqck UTSW 7 118915591 missense probably damaging 1.00
R7823:Iqck UTSW 7 118872823 missense probably damaging 1.00
R9038:Iqck UTSW 7 118899658 missense probably damaging 1.00
R9218:Iqck UTSW 7 118941679 missense probably damaging 0.98
Z1176:Iqck UTSW 7 118941654 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCCAGGCAATAGATCAGGGTGAATC -3'
(R):5'- TGGCTTCTCGGCAACAAATCCCTC -3'

Sequencing Primer
(F):5'- gtgtgtgtgtgggtggg -3'
(R):5'- CCTCACGTTCAAAGGGTTCTG -3'
Posted On 2013-11-08