Incidental Mutation 'R0898:Slc1a4'
ID83759
Institutional Source Beutler Lab
Gene Symbol Slc1a4
Ensembl Gene ENSMUSG00000020142
Gene Namesolute carrier family 1 (glutamate/neutral amino acid transporter), member 4
SynonymsASCT1
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0898 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location20302180-20332713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20304349 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 506 (T506A)
Ref Sequence ENSEMBL: ENSMUSP00000105223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004634] [ENSMUST00000109594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004634
AA Change: T426A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004634
Gene: ENSMUSG00000020142
AA Change: T426A

DomainStartEndE-ValueType
Pfam:SDF 1 397 2.7e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109594
AA Change: T506A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105223
Gene: ENSMUSG00000020142
AA Change: T506A

DomainStartEndE-ValueType
Pfam:SDF 44 477 4.2e-121 PFAM
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent neutral amino acid transporter for alanine, serine, cysteine, and threonine. Defects in this gene have been associated with developmental delay, microcephaly, and intellectual disability. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Ddx59 T C 1: 136,416,941 Y117H probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Iqck G A 7: 118,971,441 C272Y probably damaging Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Nabp1 T C 1: 51,471,337 I169V probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Sox11 T C 12: 27,341,225 Y395C probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Tpgs2 G A 18: 25,149,150 P115S probably damaging Het
Trmt10a C T 3: 138,149,518 P139L probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Slc1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Slc1a4 APN 11 20308644 splice site probably benign
IGL01889:Slc1a4 APN 11 20314089 splice site probably benign
IGL02725:Slc1a4 APN 11 20308408 missense probably damaging 1.00
IGL03409:Slc1a4 APN 11 20306506 missense probably damaging 1.00
R0085:Slc1a4 UTSW 11 20304510 splice site probably benign
R0771:Slc1a4 UTSW 11 20306467 missense probably damaging 1.00
R1326:Slc1a4 UTSW 11 20332159 missense probably damaging 1.00
R1992:Slc1a4 UTSW 11 20304375 missense probably benign 0.31
R2497:Slc1a4 UTSW 11 20332620 start gained probably benign
R3498:Slc1a4 UTSW 11 20313973 missense probably damaging 1.00
R4608:Slc1a4 UTSW 11 20304348 missense probably damaging 1.00
R4631:Slc1a4 UTSW 11 20308452 missense probably damaging 1.00
R4885:Slc1a4 UTSW 11 20304384 missense probably damaging 1.00
R4911:Slc1a4 UTSW 11 20332166 missense probably damaging 1.00
R5533:Slc1a4 UTSW 11 20304417 missense probably benign 0.01
R5548:Slc1a4 UTSW 11 20304429 missense possibly damaging 0.68
R6523:Slc1a4 UTSW 11 20332114 missense probably damaging 1.00
R6863:Slc1a4 UTSW 11 20314001 missense probably damaging 1.00
R6941:Slc1a4 UTSW 11 20304346 missense probably damaging 1.00
R7508:Slc1a4 UTSW 11 20306487 missense probably damaging 1.00
R7747:Slc1a4 UTSW 11 20308587 missense probably damaging 1.00
R7748:Slc1a4 UTSW 11 20332252 missense probably damaging 1.00
R7934:Slc1a4 UTSW 11 20308518 missense probably damaging 1.00
R8142:Slc1a4 UTSW 11 20307890 critical splice donor site probably null
R8301:Slc1a4 UTSW 11 20332286 missense probably damaging 1.00
R8398:Slc1a4 UTSW 11 20307982 missense probably damaging 1.00
X0025:Slc1a4 UTSW 11 20318703 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGATTGGGCAAAGCATTCCTTG -3'
(R):5'- TCCCCTGGTGATTCTGGGTATAGC -3'

Sequencing Primer
(F):5'- CAAAGCATTCCTTGGGAGATG -3'
(R):5'- TGATTCTGGGTATAGCATTAGTCC -3'
Posted On2013-11-08