Mutagenetix > Incidental Mutation

Incidental Mutation 'R0898:Taf2'

83764

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

150kDa, TAFII150, CIF150, 4732460C16Rik, TAF2B

MMRRC Submission

039058-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0898 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54878527-54935548 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 54923480 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 266 (T266A)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041733
AA Change: T266A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: T266A

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226864

Meta Mutation Damage Score

0.5754

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.4%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adipor1	T	A	1: 134,351,814 (GRCm39)		probably null	Het
Apmap	A	G	2: 150,427,669 (GRCm39)		probably benign	Het
Arhgap11a	T	C	2: 113,667,221 (GRCm39)	N442S	probably benign	Het
Bpifb5	C	T	2: 154,075,254 (GRCm39)	A394V	probably benign	Het
Brpf3	A	G	17: 29,025,964 (GRCm39)	T346A	possibly damaging	Het
Ccdc154	A	G	17: 25,383,055 (GRCm39)		probably benign	Het
Cdh15	G	C	8: 123,584,234 (GRCm39)	E112Q	probably damaging	Het
Col3a1	T	C	1: 45,373,153 (GRCm39)		probably benign	Het
Cpm	A	C	10: 117,512,011 (GRCm39)		probably benign	Het
Crlf2	G	C	5: 109,705,004 (GRCm39)	P67R	probably damaging	Het
Ddx59	T	C	1: 136,344,679 (GRCm39)	Y117H	probably damaging	Het
Fam241b	A	G	10: 61,944,773 (GRCm39)	F98L	probably damaging	Het
Fmn2	G	A	1: 174,331,026 (GRCm39)	G472E	unknown	Het
Gcdh	T	C	8: 85,620,189 (GRCm39)	H41R	possibly damaging	Het
Gm7713	A	C	15: 59,866,290 (GRCm39)		noncoding transcript	Het
Gmeb1	T	C	4: 131,962,093 (GRCm39)	T189A	probably benign	Het
Iqck	G	A	7: 118,570,664 (GRCm39)	C272Y	probably damaging	Het
Kcnn2	T	C	18: 45,692,543 (GRCm39)	C40R	possibly damaging	Het
Map3k1	T	C	13: 111,904,490 (GRCm39)		probably benign	Het
Nabp1	T	C	1: 51,510,496 (GRCm39)	I169V	probably benign	Het
Or14j8	T	C	17: 38,263,127 (GRCm39)	T263A	probably benign	Het
Or8c20	G	A	9: 38,260,738 (GRCm39)	V120M	probably damaging	Het
Pfkm	A	G	15: 98,026,111 (GRCm39)	I569V	probably benign	Het
Plcb1	A	T	2: 135,229,063 (GRCm39)	T1096S	possibly damaging	Het
Plscr4	A	C	9: 92,366,806 (GRCm39)	D140A	probably damaging	Het
Plxna2	A	G	1: 194,479,332 (GRCm39)	D1331G	probably damaging	Het
Ppfia4	T	C	1: 134,248,864 (GRCm39)	T498A	probably benign	Het
Prkar2b	A	T	12: 32,013,001 (GRCm39)	L372I	possibly damaging	Het
Rslcan18	T	C	13: 67,246,880 (GRCm39)	N120S	probably benign	Het
Sbf2	C	T	7: 109,970,859 (GRCm39)	V846I	possibly damaging	Het
Slc16a7	A	G	10: 125,069,370 (GRCm39)	I102T	possibly damaging	Het
Slc1a4	T	C	11: 20,254,349 (GRCm39)	T506A	probably damaging	Het
Slc22a7	T	C	17: 46,744,075 (GRCm39)	T462A	probably damaging	Het
Sox11	T	C	12: 27,391,224 (GRCm39)	Y395C	probably damaging	Het
Tanc1	C	T	2: 59,621,132 (GRCm39)	T317I	probably damaging	Het
Tnxb	T	C	17: 34,889,719 (GRCm39)	S71P	probably damaging	Het
Tpgs2	G	A	18: 25,282,207 (GRCm39)	P115S	probably damaging	Het
Trmt10a	C	T	3: 137,855,279 (GRCm39)	P139L	probably damaging	Het
Zfp113	T	C	5: 138,143,051 (GRCm39)	S400G	probably benign	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	54,934,845 (GRCm39)	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	54,919,246 (GRCm39)	nonsense	probably null
IGL00549:Taf2	APN	15	54,894,511 (GRCm39)	missense	probably benign	0.03
IGL00839:Taf2	APN	15	54,909,174 (GRCm39)	nonsense	probably null
IGL01089:Taf2	APN	15	54,879,977 (GRCm39)	missense	probably benign
IGL01305:Taf2	APN	15	54,911,670 (GRCm39)	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	54,912,882 (GRCm39)	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	54,923,412 (GRCm39)	missense	probably benign	0.03
IGL02324:Taf2	APN	15	54,891,772 (GRCm39)	missense	probably benign
IGL02328:Taf2	APN	15	54,891,772 (GRCm39)	missense	probably benign
IGL02405:Taf2	APN	15	54,897,551 (GRCm39)	splice site	probably benign
IGL02671:Taf2	APN	15	54,897,572 (GRCm39)	missense	probably benign	0.01
IGL02832:Taf2	APN	15	54,879,959 (GRCm39)	missense	probably benign	0.01
IGL03105:Taf2	APN	15	54,909,195 (GRCm39)	missense	probably benign	0.26
IGL03118:Taf2	APN	15	54,915,559 (GRCm39)	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	54,911,670 (GRCm39)	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	54,901,734 (GRCm39)	missense	probably benign	0.02
R0104:Taf2	UTSW	15	54,901,734 (GRCm39)	missense	probably benign	0.02
R0183:Taf2	UTSW	15	54,919,186 (GRCm39)	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	54,910,856 (GRCm39)	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	54,909,325 (GRCm39)	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	54,928,078 (GRCm39)	missense	probably benign	0.02
R0562:Taf2	UTSW	15	54,885,584 (GRCm39)	splice site	probably benign
R0609:Taf2	UTSW	15	54,923,446 (GRCm39)	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	54,901,690 (GRCm39)	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	54,926,461 (GRCm39)	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R0969:Taf2	UTSW	15	54,894,553 (GRCm39)	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1145:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1145:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1160:Taf2	UTSW	15	54,934,793 (GRCm39)	missense	probably benign	0.01
R1376:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R1388:Taf2	UTSW	15	54,900,021 (GRCm39)	missense	probably benign	0.00
R1416:Taf2	UTSW	15	54,901,806 (GRCm39)	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	54,923,311 (GRCm39)	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	54,925,568 (GRCm39)	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	54,879,850 (GRCm39)	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	54,934,793 (GRCm39)	missense	probably benign	0.01
R2090:Taf2	UTSW	15	54,879,882 (GRCm39)	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	54,928,042 (GRCm39)	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	54,915,643 (GRCm39)	missense	probably benign	0.03
R4073:Taf2	UTSW	15	54,915,633 (GRCm39)	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	54,922,276 (GRCm39)	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	54,922,276 (GRCm39)	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	54,922,276 (GRCm39)	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	54,929,364 (GRCm39)	missense	probably benign	0.02
R4937:Taf2	UTSW	15	54,890,619 (GRCm39)	nonsense	probably null
R5082:Taf2	UTSW	15	54,923,441 (GRCm39)	missense	probably benign	0.41
R5335:Taf2	UTSW	15	54,909,136 (GRCm39)	missense	probably benign	0.14
R5383:Taf2	UTSW	15	54,912,815 (GRCm39)	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	54,923,335 (GRCm39)	missense	probably benign	0.01
R5862:Taf2	UTSW	15	54,911,719 (GRCm39)	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	54,901,818 (GRCm39)	missense	probably benign	0.00
R5908:Taf2	UTSW	15	54,935,402 (GRCm39)	unclassified	probably benign
R6033:Taf2	UTSW	15	54,922,297 (GRCm39)	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	54,922,297 (GRCm39)	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	54,926,440 (GRCm39)	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	54,928,026 (GRCm39)	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	54,923,482 (GRCm39)	missense	probably benign	0.27
R7174:Taf2	UTSW	15	54,912,135 (GRCm39)	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	54,925,537 (GRCm39)	missense	probably benign	0.01
R7561:Taf2	UTSW	15	54,919,229 (GRCm39)	missense	probably benign	0.16
R7583:Taf2	UTSW	15	54,928,072 (GRCm39)	nonsense	probably null
R7818:Taf2	UTSW	15	54,929,326 (GRCm39)	missense	probably benign
R7905:Taf2	UTSW	15	54,910,828 (GRCm39)	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	54,912,097 (GRCm39)	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	54,928,013 (GRCm39)	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	54,928,013 (GRCm39)	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	54,894,526 (GRCm39)	missense	probably benign	0.00
R8127:Taf2	UTSW	15	54,923,384 (GRCm39)	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	54,923,384 (GRCm39)	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	54,923,384 (GRCm39)	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	54,929,361 (GRCm39)	nonsense	probably null
R8290:Taf2	UTSW	15	54,926,416 (GRCm39)	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	54,910,849 (GRCm39)	missense	probably benign	0.16
R8832:Taf2	UTSW	15	54,928,001 (GRCm39)	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	54,899,931 (GRCm39)	missense	probably benign	0.26
R8937:Taf2	UTSW	15	54,910,849 (GRCm39)	missense	probably benign	0.16
R9006:Taf2	UTSW	15	54,909,301 (GRCm39)	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	54,879,857 (GRCm39)	small deletion	probably benign
R9240:Taf2	UTSW	15	54,926,464 (GRCm39)	missense	probably null	1.00
R9257:Taf2	UTSW	15	54,929,409 (GRCm39)	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	54,911,667 (GRCm39)	missense	probably benign	0.05
R9762:Taf2	UTSW	15	54,894,440 (GRCm39)	critical splice donor site	probably null
R9766:Taf2	UTSW	15	54,910,881 (GRCm39)	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	54,910,832 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGGCATCCTCTACTTGAAGGGAC -3'
(R):5'- CGTTGGGCATGTGAAAGCCATTG -3'

Sequencing Primer
(F):5'- TTGAAGGGACACCAACCTG -3'
(R):5'- GACACATAAGAGATTATGCTAAGCC -3'

Posted On

2013-11-08