Incidental Mutation 'R0898:Tpgs2'
ID83772
Institutional Source Beutler Lab
Gene Symbol Tpgs2
Ensembl Gene ENSMUSG00000024269
Gene Nametubulin polyglutamylase complex subunit 2
Synonyms
MMRRC Submission 039058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0898 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location25127223-25169007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25149150 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 115 (P115S)
Ref Sequence ENSEMBL: ENSMUSP00000122538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115817] [ENSMUST00000148255]
Predicted Effect probably damaging
Transcript: ENSMUST00000115817
AA Change: P115S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111484
Gene: ENSMUSG00000024269
AA Change: P115S

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
low complexity region 253 264 N/A INTRINSIC
low complexity region 271 293 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148255
AA Change: P115S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269
AA Change: P115S

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Meta Mutation Damage Score 0.1199 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipor1 T A 1: 134,424,076 probably null Het
Apmap A G 2: 150,585,749 probably benign Het
Arhgap11a T C 2: 113,836,876 N442S probably benign Het
Bpifb5 C T 2: 154,233,334 A394V probably benign Het
Brpf3 A G 17: 28,806,990 T346A possibly damaging Het
Ccdc154 A G 17: 25,164,081 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Col3a1 T C 1: 45,333,993 probably benign Het
Cpm A C 10: 117,676,106 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Ddx59 T C 1: 136,416,941 Y117H probably damaging Het
Fam241b A G 10: 62,108,994 F98L probably damaging Het
Fmn2 G A 1: 174,503,460 G472E unknown Het
Gcdh T C 8: 84,893,560 H41R possibly damaging Het
Gm7713 A C 15: 59,994,441 noncoding transcript Het
Gmeb1 T C 4: 132,234,782 T189A probably benign Het
Iqck G A 7: 118,971,441 C272Y probably damaging Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Map3k1 T C 13: 111,767,956 probably benign Het
Nabp1 T C 1: 51,471,337 I169V probably benign Het
Olfr761 T C 17: 37,952,236 T263A probably benign Het
Olfr898 G A 9: 38,349,442 V120M probably damaging Het
Pfkm A G 15: 98,128,230 I569V probably benign Het
Plcb1 A T 2: 135,387,143 T1096S possibly damaging Het
Plscr4 A C 9: 92,484,753 D140A probably damaging Het
Plxna2 A G 1: 194,797,024 D1331G probably damaging Het
Ppfia4 T C 1: 134,321,126 T498A probably benign Het
Prkar2b A T 12: 31,963,002 L372I possibly damaging Het
Rslcan18 T C 13: 67,098,816 N120S probably benign Het
Sbf2 C T 7: 110,371,652 V846I possibly damaging Het
Slc16a7 A G 10: 125,233,501 I102T possibly damaging Het
Slc1a4 T C 11: 20,304,349 T506A probably damaging Het
Slc22a7 T C 17: 46,433,149 T462A probably damaging Het
Sox11 T C 12: 27,341,225 Y395C probably damaging Het
Taf2 T C 15: 55,060,084 T266A probably damaging Het
Tanc1 C T 2: 59,790,788 T317I probably damaging Het
Tnxb T C 17: 34,670,745 S71P probably damaging Het
Trmt10a C T 3: 138,149,518 P139L probably damaging Het
Zfp113 T C 5: 138,144,789 S400G probably benign Het
Other mutations in Tpgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Tpgs2 APN 18 25140580 missense possibly damaging 0.93
IGL02184:Tpgs2 APN 18 25140573 missense probably damaging 1.00
IGL02234:Tpgs2 APN 18 25149244 critical splice acceptor site probably null
IGL02747:Tpgs2 APN 18 25139145 intron probably benign
PIT4466001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
PIT4472001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
R0004:Tpgs2 UTSW 18 25158238 splice site probably benign
R0139:Tpgs2 UTSW 18 25149185 missense probably damaging 1.00
R1415:Tpgs2 UTSW 18 25168553 missense probably damaging 1.00
R1590:Tpgs2 UTSW 18 25140573 missense probably damaging 1.00
R1974:Tpgs2 UTSW 18 25140536 missense probably damaging 1.00
R2144:Tpgs2 UTSW 18 25168541 missense possibly damaging 0.93
R4811:Tpgs2 UTSW 18 25129840 intron probably benign
R4851:Tpgs2 UTSW 18 25151248 missense possibly damaging 0.94
R6386:Tpgs2 UTSW 18 25139024 missense possibly damaging 0.74
R6564:Tpgs2 UTSW 18 25158287 missense probably damaging 0.99
R6788:Tpgs2 UTSW 18 25129870 missense probably benign 0.04
R7112:Tpgs2 UTSW 18 25149137 missense probably damaging 1.00
R7824:Tpgs2 UTSW 18 25129865 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGAGAAGGGTTAGTTTAACGGAGCAT -3'
(R):5'- ACATGAAAGGCTAGTGGTCTGAGGTA -3'

Sequencing Primer
(F):5'- TTAACGGAGCATAGGGTTAATGATAC -3'
(R):5'- GGCCATGAAGCCATTCTTG -3'
Posted On2013-11-08