Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Astn1'

83777

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

158362273-158691781 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 158511109 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 475 (C475*)

Ref Sequence

ENSEMBL: ENSMUSP00000141518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]

Predicted Effect

probably null
Transcript: ENSMUST00000046110
AA Change: C475*

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: C475*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000170718
AA Change: C475*

SMART Domains

Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: C475*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
Blast:MACPF	811	835	3e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192619

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192868

Predicted Effect

probably null
Transcript: ENSMUST00000193042
AA Change: C475*

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: C475*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000194369
AA Change: C475*

SMART Domains

Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: C475*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
Blast:MACPF	803	828	2e-7	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000195311
AA Change: C475*

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: C475*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158600319	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158504313	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158580327	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158668631	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158511154	intron	probably benign
IGL02168:Astn1	APN	1	158609341	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158664130	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158510950	splice site	probably benign
IGL02307:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158502408	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158505395	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158688550	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158612395	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158668623	splice site	probably benign
IGL03354:Astn1	APN	1	158688604	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158597209	missense	probably benign	0.20
PIT4366001:Astn1	UTSW	1	158597211	missense	probably benign	0.23
R0024:Astn1	UTSW	1	158684215	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158579724	splice site	probably benign
R0099:Astn1	UTSW	1	158502151	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158688548	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158509891	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158600389	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158472389	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158509890	missense	possibly damaging	0.93
R1027:Astn1	UTSW	1	158580279	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158600365	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158502353	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158579576	splice site	probably benign
R1701:Astn1	UTSW	1	158504307	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158504251	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158601945	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158505316	splice site	probably null
R1919:Astn1	UTSW	1	158509971	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158520521	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158609305	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158657120	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158600502	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158472408	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158667609	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158502150	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158657306	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158579666	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158612346	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158572951	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158667532	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158502060	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158579657	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158502032	splice site	probably null
R4625:Astn1	UTSW	1	158580294	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158502251	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158612532	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158580363	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158600380	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158601937	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158509993	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158664121	nonsense	probably null
R6481:Astn1	UTSW	1	158612462	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158511148	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158612472	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158664074	nonsense	probably null
R7062:Astn1	UTSW	1	158688511	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158572987	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158664276	splice site	probably null
R7402:Astn1	UTSW	1	158552855	intron	probably benign
R7412:Astn1	UTSW	1	158502349	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158610782	splice site	probably null
R7537:Astn1	UTSW	1	158505386	missense	possibly damaging	0.84
R7537:Astn1	UTSW	1	158667638	splice site	probably null
R7635:Astn1	UTSW	1	158667535	nonsense	probably null
R7890:Astn1	UTSW	1	158580333	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158601938	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158597316	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158688638	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158504350	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158609320	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158609280	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158502233	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158657100	missense	probably benign	0.09
Z1088:Astn1	UTSW	1	158472497	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158597206	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158684096	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAATTAGGATGTGCCCTGCCTC -3'
(R):5'- ATGCTCAGTGACTCAACCACATGG -3'

Sequencing Primer
(F):5'- CTGGTGACTTGTGCCCCTG -3'
(R):5'- TTGCAAAAGGCATGCGCT -3'

Posted On

2013-11-08