Incidental Mutation 'R0899:Olfr1026'
ID83781
Institutional Source Beutler Lab
Gene Symbol Olfr1026
Ensembl Gene ENSMUSG00000042863
Gene Nameolfactory receptor 1026
SynonymsGA_x6K02T2Q125-47402610-47403533, MOR196-4
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85921558-85924623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85923387 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000151927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056718] [ENSMUST00000188749] [ENSMUST00000213474] [ENSMUST00000217615] [ENSMUST00000219615]
Predicted Effect probably benign
Transcript: ENSMUST00000056718
AA Change: T40A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049887
Gene: ENSMUSG00000042863
AA Change: T40A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-58 PFAM
Pfam:7tm_1 41 290 9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188749
SMART Domains Protein: ENSMUSP00000139860
Gene: ENSMUSG00000058884

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 7.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213474
Predicted Effect probably benign
Transcript: ENSMUST00000217615
AA Change: T40A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219615
AA Change: T40A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Olfr1026
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Olfr1026 APN 2 85924077 missense possibly damaging 0.81
PIT4151001:Olfr1026 UTSW 2 85924042 missense probably damaging 1.00
R0147:Olfr1026 UTSW 2 85924018 missense possibly damaging 0.61
R0601:Olfr1026 UTSW 2 85923378 missense probably benign 0.01
R1728:Olfr1026 UTSW 2 85924122 missense possibly damaging 0.48
R2004:Olfr1026 UTSW 2 85923595 splice site probably null
R2020:Olfr1026 UTSW 2 85923743 missense probably benign
R2396:Olfr1026 UTSW 2 85923925 missense probably benign 0.00
R2519:Olfr1026 UTSW 2 85923607 missense probably damaging 1.00
R3153:Olfr1026 UTSW 2 85923730 missense probably benign
R4696:Olfr1026 UTSW 2 85918871 splice site probably null
R5034:Olfr1026 UTSW 2 85923547 missense probably damaging 0.99
R5221:Olfr1026 UTSW 2 85924149 missense probably damaging 1.00
R5334:Olfr1026 UTSW 2 85923714 missense probably damaging 1.00
R6041:Olfr1026 UTSW 2 85923391 missense probably damaging 1.00
R7602:Olfr1026 UTSW 2 85923802 missense probably damaging 1.00
R8075:Olfr1026 UTSW 2 85924126 missense probably benign 0.18
Z1088:Olfr1026 UTSW 2 85923798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTGCATTTACGAGTCGGAAGG -3'
(R):5'- GGTCCACAAAAGGTTAAACGAAGCATC -3'

Sequencing Primer
(F):5'- AGAAGACTCAGAATCAGATAGACAC -3'
(R):5'- GACAGACTCTTCGGGACATTTTAC -3'
Posted On2013-11-08