Incidental Mutation 'R0899:Dthd1'
ID83787
Institutional Source Beutler Lab
Gene Symbol Dthd1
Ensembl Gene ENSMUSG00000090326
Gene Namedeath domain containing 1
SynonymsGm17384
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location62813823-62888308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62842928 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 531 (H531R)
Ref Sequence ENSEMBL: ENSMUSP00000131534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170704]
Predicted Effect probably benign
Transcript: ENSMUST00000170704
AA Change: H531R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131534
Gene: ENSMUSG00000090326
AA Change: H531R

DomainStartEndE-ValueType
Pfam:Death 693 778 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a death domain. Death domain-containing proteins function in signaling pathways and formation of signaling complexes, as well as the apoptosis pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Dthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Boatman UTSW 5 62818715 missense probably benign 0.28
Coin UTSW 5 62842916 missense probably damaging 0.98
FR4340:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4342:Dthd1 UTSW 5 62843026 small insertion probably benign
FR4589:Dthd1 UTSW 5 62843026 frame shift probably null
FR4976:Dthd1 UTSW 5 62843024 small insertion probably benign
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0096:Dthd1 UTSW 5 62843040 missense possibly damaging 0.75
R0395:Dthd1 UTSW 5 62814333 missense possibly damaging 0.71
R0734:Dthd1 UTSW 5 62839410 splice site probably benign
R0970:Dthd1 UTSW 5 62887981 missense probably damaging 1.00
R1104:Dthd1 UTSW 5 62821959 missense probably damaging 1.00
R1518:Dthd1 UTSW 5 62822040 missense probably damaging 1.00
R1831:Dthd1 UTSW 5 62827229 missense probably benign 0.02
R2110:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2110:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2112:Dthd1 UTSW 5 62821908 missense probably damaging 1.00
R2112:Dthd1 UTSW 5 62842879 missense probably damaging 0.99
R2248:Dthd1 UTSW 5 62849900 missense probably damaging 0.99
R2311:Dthd1 UTSW 5 62839237 splice site probably benign
R2937:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R2938:Dthd1 UTSW 5 62842957 missense probably benign 0.02
R3835:Dthd1 UTSW 5 62849785 missense probably damaging 1.00
R3855:Dthd1 UTSW 5 62827129 missense probably benign 0.21
R3855:Dthd1 UTSW 5 62888023 missense probably benign 0.00
R4049:Dthd1 UTSW 5 62827165 nonsense probably null
R4321:Dthd1 UTSW 5 62818690 missense probably damaging 0.99
R4353:Dthd1 UTSW 5 62842867 missense probably benign 0.04
R4560:Dthd1 UTSW 5 62827092 missense probably damaging 1.00
R4613:Dthd1 UTSW 5 62827068 missense probably damaging 1.00
R4689:Dthd1 UTSW 5 62842912 missense probably damaging 0.99
R4715:Dthd1 UTSW 5 62888187 missense probably benign
R4718:Dthd1 UTSW 5 62818793 missense probably damaging 1.00
R4967:Dthd1 UTSW 5 62888206 missense probably benign 0.01
R5068:Dthd1 UTSW 5 62818716 missense probably benign
R5089:Dthd1 UTSW 5 62849905 missense probably benign
R5355:Dthd1 UTSW 5 62839387 missense probably damaging 1.00
R5470:Dthd1 UTSW 5 62818766 missense probably damaging 1.00
R6284:Dthd1 UTSW 5 62814041 missense possibly damaging 0.71
R6293:Dthd1 UTSW 5 62842850 missense probably damaging 0.99
R6484:Dthd1 UTSW 5 62814332 missense probably benign 0.34
R6516:Dthd1 UTSW 5 62839264 missense probably benign 0.16
R6741:Dthd1 UTSW 5 62842946 missense probably damaging 1.00
R6810:Dthd1 UTSW 5 62814329 missense probably benign 0.01
R7565:Dthd1 UTSW 5 62843092 missense probably damaging 1.00
R7595:Dthd1 UTSW 5 62818715 missense probably benign 0.28
R7947:Dthd1 UTSW 5 62814310 missense possibly damaging 0.90
R8131:Dthd1 UTSW 5 62842916 missense probably damaging 0.98
R8356:Dthd1 UTSW 5 62849738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTTTCAATGCTTCATTCCCTGCTA -3'
(R):5'- TGTGCAGAGAAAAGTGCCTAAAAGGATT -3'

Sequencing Primer
(F):5'- GCTACTTTCCCTTTGCACAGG -3'
(R):5'- TGCAACTAAAATGTGTGGCTAAAAG -3'
Posted On2013-11-08