Incidental Mutation 'R0899:Gm4763'
ID83793
Institutional Source Beutler Lab
Gene Symbol Gm4763
Ensembl Gene ENSMUSG00000058717
Gene Namepredicted gene 4763
Synonyms
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24715023-24726908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24723312 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 112 (R112H)
Ref Sequence ENSEMBL: ENSMUSP00000080361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081657] [ENSMUST00000205376]
Predicted Effect probably benign
Transcript: ENSMUST00000081657
AA Change: R112H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080361
Gene: ENSMUSG00000058717
AA Change: R112H

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:UPAR_LY6 88 165 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206243
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Gm4763
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Gm4763 APN 7 24723506 missense probably damaging 0.99
IGL02953:Gm4763 APN 7 24723566 missense probably damaging 1.00
IGL03349:Gm4763 APN 7 24722836 missense probably damaging 0.99
R0144:Gm4763 UTSW 7 24723590 missense possibly damaging 0.85
R0485:Gm4763 UTSW 7 24722745 missense possibly damaging 0.84
R0652:Gm4763 UTSW 7 24724197 missense possibly damaging 0.96
R0963:Gm4763 UTSW 7 24723622 missense probably benign 0.00
R5290:Gm4763 UTSW 7 24723411 missense probably benign 0.04
R6134:Gm4763 UTSW 7 24726056 missense probably damaging 1.00
R7128:Gm4763 UTSW 7 24725999 critical splice donor site probably null
R7191:Gm4763 UTSW 7 24723334 missense possibly damaging 0.88
X0062:Gm4763 UTSW 7 24723299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACACTTCATCCGCTAGAGCAAC -3'
(R):5'- CAACAGTGCTAACAGCACCAGTGTC -3'

Sequencing Primer
(F):5'- GAGCAACCCATGCCTCTG -3'
(R):5'- CGTGAAACTTTCAGGTAAGTGACC -3'
Posted On2013-11-08