Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Scnn1b'

83794

Institutional Source

Beutler Lab

Gene Symbol

Scnn1b

Ensembl Gene

ENSMUSG00000030873

Gene Name

sodium channel, nonvoltage-gated 1 beta

Synonyms

ENaC beta

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121865038-121918514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121917715 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 525 (G525S)

Ref Sequence

ENSEMBL: ENSMUSP00000033161 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033161] [ENSMUST00000205438] [ENSMUST00000205520]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033161
AA Change: G525S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033161
Gene: ENSMUSG00000030873
AA Change: G525S

Domain	Start	End	E-Value	Type
Pfam:ASC	29	541	2.4e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205438

Predicted Effect

probably benign
Transcript: ENSMUST00000205520

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the beta subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), and Liddle syndrome. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, decreased serum sodium levels but higher urine sodium levels and increased serum potassium and chloride levels but lower potassium urine levels. Another homozygous mutation exhibits no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Scnn1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Scnn1b	APN	7	121918036	missense	probably damaging	1.00
IGL01108:Scnn1b	APN	7	121914332	splice site	probably null
IGL02191:Scnn1b	APN	7	121917513	missense	probably damaging	1.00
IGL02197:Scnn1b	APN	7	121902890	missense	probably null	0.89
IGL02355:Scnn1b	APN	7	121917547	missense	probably damaging	1.00
IGL02362:Scnn1b	APN	7	121917547	missense	probably damaging	1.00
IGL02554:Scnn1b	APN	7	121917523	missense	probably damaging	1.00
IGL02834:Scnn1b	APN	7	121912062	missense	probably damaging	1.00
R0266:Scnn1b	UTSW	7	121912475	missense	probably damaging	1.00
R0494:Scnn1b	UTSW	7	121899458	missense	probably damaging	1.00
R0849:Scnn1b	UTSW	7	121912475	missense	probably damaging	1.00
R0872:Scnn1b	UTSW	7	121914330	critical splice donor site	probably null
R1386:Scnn1b	UTSW	7	121902488	missense	possibly damaging	0.60
R1406:Scnn1b	UTSW	7	121902544	critical splice donor site	probably null
R1406:Scnn1b	UTSW	7	121902544	critical splice donor site	probably null
R1662:Scnn1b	UTSW	7	121902328	missense	probably benign	0.00
R1782:Scnn1b	UTSW	7	121917961	missense	probably benign
R1829:Scnn1b	UTSW	7	121902845	missense	probably benign	0.00
R1861:Scnn1b	UTSW	7	121914261	missense	probably damaging	1.00
R1928:Scnn1b	UTSW	7	121910447	missense	probably damaging	1.00
R4016:Scnn1b	UTSW	7	121914332	splice site	probably null
R4192:Scnn1b	UTSW	7	121902739	missense	possibly damaging	0.63
R4504:Scnn1b	UTSW	7	121912475	missense	probably damaging	1.00
R4745:Scnn1b	UTSW	7	121902286	missense	probably benign	0.03
R4888:Scnn1b	UTSW	7	121902887	missense	probably benign	0.06
R4941:Scnn1b	UTSW	7	121912008	missense	probably damaging	1.00
R5121:Scnn1b	UTSW	7	121902887	missense	probably benign	0.06
R6379:Scnn1b	UTSW	7	121915328	missense	probably benign	0.10
R6516:Scnn1b	UTSW	7	121912112	missense	probably damaging	1.00
R6650:Scnn1b	UTSW	7	121902820	missense	probably damaging	0.97
R6730:Scnn1b	UTSW	7	121902877	missense	probably damaging	1.00
R7151:Scnn1b	UTSW	7	121917886	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAACAATGTAAGTGTGGGTGTG -3'
(R):5'- GGCCTAATGAAACGAGGCACTGAC -3'

Sequencing Primer
(F):5'- GTGTGCCTGGTGTGTGG -3'
(R):5'- AGCCTCAGGGAGTCATAGTTG -3'

Posted On

2013-11-08