Mutagenetix > Incidental Mutation

Incidental Mutation 'R0899:Tktl2'

83795

Institutional Source

Beutler Lab

Gene Symbol

Tktl2

Ensembl Gene

ENSMUSG00000025519

Gene Name

transketolase-like 2

Synonyms

4933401I19Rik

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.504) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66511756-66518335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 66512347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 186 (V186M)

Ref Sequence

ENSEMBL: ENSMUSP00000138388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002025] [ENSMUST00000183187]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000002025
AA Change: V186M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000002025
Gene: ENSMUSG00000025519
AA Change: V186M

Domain	Start	End	E-Value	Type
Pfam:DXP_synthase_N	2	195	2.4e-9	PFAM
Pfam:Transketolase_N	16	281	4.6e-50	PFAM
Pfam:TPP_enzyme_C	108	250	5.9e-8	PFAM
Pfam:E1_dh	111	249	2.9e-13	PFAM
Transket_pyr	320	484	3.74e-51	SMART
Pfam:Transketolase_C	495	617	1.4e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000183187
AA Change: V186M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138388
Gene: ENSMUSG00000025519
AA Change: V186M

Domain	Start	End	E-Value	Type
Pfam:DXP_synthase_N	2	197	8.2e-9	PFAM
Pfam:Transketolase_N	16	280	2.2e-86	PFAM
Pfam:TPP_enzyme_C	108	250	5.9e-8	PFAM
Pfam:E1_dh	110	251	2.1e-14	PFAM
Transket_pyr	320	484	3.74e-51	SMART
Pfam:Transketolase_C	495	617	3.4e-30	PFAM

Meta Mutation Damage Score

0.1037

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S		Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Tktl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01351:Tktl2	APN	8	66512896	missense	probably benign	0.00
IGL02444:Tktl2	APN	8	66513361	missense	possibly damaging	0.60
IGL02798:Tktl2	APN	8	66513311	missense	probably benign	0.06
IGL02938:Tktl2	APN	8	66512330	missense	probably damaging	1.00
IGL03095:Tktl2	APN	8	66512284	missense	probably damaging	1.00
R0530:Tktl2	UTSW	8	66513179	missense	probably damaging	0.99
R0900:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1080:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1419:Tktl2	UTSW	8	66513038	missense	probably damaging	0.97
R1609:Tktl2	UTSW	8	66512852	missense	probably benign	0.04
R1717:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1718:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1719:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1848:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1933:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R1934:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R2134:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R2135:Tktl2	UTSW	8	66512347	missense	probably damaging	0.98
R2314:Tktl2	UTSW	8	66513143	missense	probably damaging	1.00
R2509:Tktl2	UTSW	8	66512852	missense	probably benign	0.04
R2511:Tktl2	UTSW	8	66512852	missense	probably benign	0.04
R2965:Tktl2	UTSW	8	66512063	missense	probably benign	0.01
R3084:Tktl2	UTSW	8	66513206	missense	possibly damaging	0.88
R3085:Tktl2	UTSW	8	66513206	missense	possibly damaging	0.88
R3121:Tktl2	UTSW	8	66512156	missense	probably damaging	0.98
R3499:Tktl2	UTSW	8	66513245	missense	probably damaging	0.97
R4227:Tktl2	UTSW	8	66513699	splice site	probably null
R4284:Tktl2	UTSW	8	66513156	missense	probably damaging	1.00
R4491:Tktl2	UTSW	8	66512012	missense	probably damaging	0.96
R5478:Tktl2	UTSW	8	66513398	missense	probably damaging	0.99
R5801:Tktl2	UTSW	8	66513647	missense	probably benign	0.00
R6656:Tktl2	UTSW	8	66512729	missense	probably benign
R6864:Tktl2	UTSW	8	66512339	missense	probably damaging	1.00
R6915:Tktl2	UTSW	8	66513035	missense	probably damaging	1.00
R7168:Tktl2	UTSW	8	66513101	missense	probably damaging	1.00
R7442:Tktl2	UTSW	8	66512909	missense	possibly damaging	0.95
R7617:Tktl2	UTSW	8	66512999	missense	probably benign	0.07
R7687:Tktl2	UTSW	8	66513101	missense	probably damaging	1.00
R8825:Tktl2	UTSW	8	66513667	missense	possibly damaging	0.87
R9155:Tktl2	UTSW	8	66513206	missense	possibly damaging	0.88
R9176:Tktl2	UTSW	8	66512012	missense	probably damaging	0.96
R9352:Tktl2	UTSW	8	66513322	missense	possibly damaging	0.88
R9514:Tktl2	UTSW	8	66513188	missense	probably damaging	0.98
RF006:Tktl2	UTSW	8	66512852	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TGGAATGGCTTACACCGGCAAATAC -3'
(R):5'- CTGATCCTGGGCGAGTCTTCAATG -3'

Sequencing Primer
(F):5'- TACTTTGACAAGGCCAGCTAC -3'
(R):5'- GGAATACCTCTACCCTTGAAGGTC -3'

Posted On

2013-11-08