Incidental Mutation 'R0899:Tktl2'
ID83795
Institutional Source Beutler Lab
Gene Symbol Tktl2
Ensembl Gene ENSMUSG00000025519
Gene Nametransketolase-like 2
Synonyms4933401I19Rik
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location66511756-66518335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66512347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 186 (V186M)
Ref Sequence ENSEMBL: ENSMUSP00000138388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002025] [ENSMUST00000183187]
Predicted Effect probably damaging
Transcript: ENSMUST00000002025
AA Change: V186M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002025
Gene: ENSMUSG00000025519
AA Change: V186M

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 195 2.4e-9 PFAM
Pfam:Transketolase_N 16 281 4.6e-50 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 111 249 2.9e-13 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 1.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183187
AA Change: V186M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138388
Gene: ENSMUSG00000025519
AA Change: V186M

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 197 8.2e-9 PFAM
Pfam:Transketolase_N 16 280 2.2e-86 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 110 251 2.1e-14 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 3.4e-30 PFAM
Meta Mutation Damage Score 0.1037 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Tktl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Tktl2 APN 8 66512896 missense probably benign 0.00
IGL02444:Tktl2 APN 8 66513361 missense possibly damaging 0.60
IGL02798:Tktl2 APN 8 66513311 missense probably benign 0.06
IGL02938:Tktl2 APN 8 66512330 missense probably damaging 1.00
IGL03095:Tktl2 APN 8 66512284 missense probably damaging 1.00
R0530:Tktl2 UTSW 8 66513179 missense probably damaging 0.99
R0900:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1080:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1419:Tktl2 UTSW 8 66513038 missense probably damaging 0.97
R1609:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R1717:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1718:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1719:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1848:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1933:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1934:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2134:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2135:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2314:Tktl2 UTSW 8 66513143 missense probably damaging 1.00
R2509:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2511:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2965:Tktl2 UTSW 8 66512063 missense probably benign 0.01
R3084:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3085:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3121:Tktl2 UTSW 8 66512156 missense probably damaging 0.98
R3499:Tktl2 UTSW 8 66513245 missense probably damaging 0.97
R4227:Tktl2 UTSW 8 66513699 splice site probably null
R4284:Tktl2 UTSW 8 66513156 missense probably damaging 1.00
R4491:Tktl2 UTSW 8 66512012 missense probably damaging 0.96
R5478:Tktl2 UTSW 8 66513398 missense probably damaging 0.99
R5801:Tktl2 UTSW 8 66513647 missense probably benign 0.00
R6656:Tktl2 UTSW 8 66512729 missense probably benign
R6864:Tktl2 UTSW 8 66512339 missense probably damaging 1.00
R6915:Tktl2 UTSW 8 66513035 missense probably damaging 1.00
R7168:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
R7442:Tktl2 UTSW 8 66512909 missense possibly damaging 0.95
R7617:Tktl2 UTSW 8 66512999 missense probably benign 0.07
R7687:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
RF006:Tktl2 UTSW 8 66512852 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGGAATGGCTTACACCGGCAAATAC -3'
(R):5'- CTGATCCTGGGCGAGTCTTCAATG -3'

Sequencing Primer
(F):5'- TACTTTGACAAGGCCAGCTAC -3'
(R):5'- GGAATACCTCTACCCTTGAAGGTC -3'
Posted On2013-11-08