Incidental Mutation 'R0899:Jam3'
ID 83798
Institutional Source Beutler Lab
Gene Symbol Jam3
Ensembl Gene ENSMUSG00000031990
Gene Name junction adhesion molecule 3
Synonyms 1110002N23Rik, Jcam3, JAM-C, JAM-3
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock # R0899 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 27097384-27155421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 27098957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 244 (G244W)
Ref Sequence ENSEMBL: ENSMUSP00000034472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034472] [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
AlphaFold Q9D8B7
Predicted Effect probably damaging
Transcript: ENSMUST00000034472
AA Change: G244W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990
AA Change: G244W

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
IGc2 151 226 8.12e-13 SMART
transmembrane domain 245 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073127
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086198
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167074
SMART Domains Protein: ENSMUSP00000128003
Gene: ENSMUSG00000031990

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 24 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
Pfam:C2-set_2 138 206 4.8e-7 PFAM
Pfam:Ig_3 139 206 7.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215446
Predicted Effect probably benign
Transcript: ENSMUST00000216677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217654
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Approximately 60% of mice homozygous for a targeted mutation exhibit postnatal lethality. Males are infertile and display small testes and arrested differentiation of round spermatids into spermatozoa, as shown by the absence of acrosomes, elongated nuclei, and morphological signs of polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Jam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Jam3 APN 9 27101892 missense probably damaging 1.00
IGL01311:Jam3 APN 9 27098723 missense probably damaging 0.99
IGL01729:Jam3 APN 9 27105525 missense probably damaging 1.00
IGL03233:Jam3 APN 9 27101921 missense probably damaging 1.00
IGL03275:Jam3 APN 9 27101249 missense probably damaging 0.99
R0267:Jam3 UTSW 9 27106405 missense probably benign 0.01
R0547:Jam3 UTSW 9 27098888 missense probably damaging 1.00
R1499:Jam3 UTSW 9 27106405 missense possibly damaging 0.93
R3926:Jam3 UTSW 9 27106405 missense possibly damaging 0.93
R4044:Jam3 UTSW 9 27101863 critical splice donor site probably null
R4977:Jam3 UTSW 9 27098373 missense probably damaging 0.96
R6527:Jam3 UTSW 9 27155344 missense unknown
R6759:Jam3 UTSW 9 27101980 missense probably benign 0.09
R7843:Jam3 UTSW 9 27106416 critical splice acceptor site probably null
R8088:Jam3 UTSW 9 27098860 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTAGTTAACACCGTCATGCTTCCC -3'
(R):5'- TGGTAAGCATCTCTCAGTGGCTTTG -3'

Sequencing Primer
(F):5'- TGTGAACACAAGAGGACAGCTC -3'
(R):5'- TCTTACCCAGAGAGATGTTAATGG -3'
Posted On 2013-11-08