Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Olfr790'

83802

Institutional Source

Beutler Lab

Gene Symbol

Olfr790

Ensembl Gene

ENSMUSG00000044025

Gene Name

olfactory receptor 790

Synonyms

GA_x6K02T2PULF-11179777-11180721, MOR112-1

MMRRC Submission

039059-MU

Accession Numbers

Genbank: NM_146933

Is this an essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129498492-129503342 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129501432 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 183 (F183L)

Ref Sequence

ENSEMBL: ENSMUSP00000151759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056002] [ENSMUST00000203966] [ENSMUST00000215067] [ENSMUST00000218901]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056002
AA Change: F175L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052235
Gene: ENSMUSG00000044025
AA Change: F175L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	37	315	5.6e-53	PFAM
Pfam:7tm_1	47	296	1.3e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203966
AA Change: F175L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145450
Gene: ENSMUSG00000044025
AA Change: F175L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	37	315	5.6e-53	PFAM
Pfam:7tm_1	47	296	1.3e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215067
AA Change: F175L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218901
AA Change: F183L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Olfr790

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01132:Olfr790	APN	10	129501646	missense	probably damaging	1.00
IGL01575:Olfr790	APN	10	129501567	missense	probably benign	0.01
IGL02389:Olfr790	APN	10	129501070	missense	probably benign
IGL02601:Olfr790	APN	10	129501854	makesense	probably null
G5030:Olfr790	UTSW	10	129501537	missense	probably benign	0.00
R0785:Olfr790	UTSW	10	129500881	critical splice acceptor site	probably null
R0850:Olfr790	UTSW	10	129501724	missense	probably damaging	0.99
R1167:Olfr790	UTSW	10	129501150	missense	probably benign	0.03
R1515:Olfr790	UTSW	10	129501591	missense	probably damaging	1.00
R1557:Olfr790	UTSW	10	129501622	missense	probably damaging	1.00
R1759:Olfr790	UTSW	10	129500906	missense	probably benign	0.00
R1892:Olfr790	UTSW	10	129501033	missense	probably benign	0.02
R4296:Olfr790	UTSW	10	129501470	nonsense	probably null
R4681:Olfr790	UTSW	10	129501564	missense	probably damaging	1.00
R5046:Olfr790	UTSW	10	129501309	missense	possibly damaging	0.57
R5309:Olfr790	UTSW	10	129501514	missense	probably damaging	1.00
R5312:Olfr790	UTSW	10	129501514	missense	probably damaging	1.00
R5550:Olfr790	UTSW	10	129501783	missense	probably damaging	1.00
R5788:Olfr790	UTSW	10	129500894	missense	probably benign
R5788:Olfr790	UTSW	10	129500910	start codon destroyed	probably null	0.99
R7457:Olfr790	UTSW	10	129501706	missense	probably damaging	1.00
R7782:Olfr790	UTSW	10	129501151	missense	probably benign	0.01
R7969:Olfr790	UTSW	10	129501847	missense	probably benign	0.14
R8512:Olfr790	UTSW	10	129501627	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAAGTGTGACTGGGAACCTCATC -3'
(R):5'- CCTCTCCCTTGCAGAAGGCTTAATG -3'

Sequencing Primer
(F):5'- GTGACTGGGAACCTCATCATTATC -3'
(R):5'- CCATAAGAGAGGGAGACAACTATC -3'

Posted On

2013-11-08