Incidental Mutation 'R0899:Olfr790'
ID83802
Institutional Source Beutler Lab
Gene Symbol Olfr790
Ensembl Gene ENSMUSG00000044025
Gene Nameolfactory receptor 790
SynonymsGA_x6K02T2PULF-11179777-11180721, MOR112-1
MMRRC Submission 039059-MU
Accession Numbers

Genbank: NM_146933

Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129498492-129503342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129501432 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 183 (F183L)
Ref Sequence ENSEMBL: ENSMUSP00000151759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056002] [ENSMUST00000203966] [ENSMUST00000215067] [ENSMUST00000218901]
Predicted Effect probably damaging
Transcript: ENSMUST00000056002
AA Change: F175L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052235
Gene: ENSMUSG00000044025
AA Change: F175L

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 5.6e-53 PFAM
Pfam:7tm_1 47 296 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203966
AA Change: F175L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145450
Gene: ENSMUSG00000044025
AA Change: F175L

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 5.6e-53 PFAM
Pfam:7tm_1 47 296 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215067
AA Change: F175L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218901
AA Change: F183L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Olfr790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Olfr790 APN 10 129501646 missense probably damaging 1.00
IGL01575:Olfr790 APN 10 129501567 missense probably benign 0.01
IGL02389:Olfr790 APN 10 129501070 missense probably benign
IGL02601:Olfr790 APN 10 129501854 makesense probably null
G5030:Olfr790 UTSW 10 129501537 missense probably benign 0.00
R0785:Olfr790 UTSW 10 129500881 critical splice acceptor site probably null
R0850:Olfr790 UTSW 10 129501724 missense probably damaging 0.99
R1167:Olfr790 UTSW 10 129501150 missense probably benign 0.03
R1515:Olfr790 UTSW 10 129501591 missense probably damaging 1.00
R1557:Olfr790 UTSW 10 129501622 missense probably damaging 1.00
R1759:Olfr790 UTSW 10 129500906 missense probably benign 0.00
R1892:Olfr790 UTSW 10 129501033 missense probably benign 0.02
R4296:Olfr790 UTSW 10 129501470 nonsense probably null
R4681:Olfr790 UTSW 10 129501564 missense probably damaging 1.00
R5046:Olfr790 UTSW 10 129501309 missense possibly damaging 0.57
R5309:Olfr790 UTSW 10 129501514 missense probably damaging 1.00
R5312:Olfr790 UTSW 10 129501514 missense probably damaging 1.00
R5550:Olfr790 UTSW 10 129501783 missense probably damaging 1.00
R5788:Olfr790 UTSW 10 129500894 missense probably benign
R5788:Olfr790 UTSW 10 129500910 start codon destroyed probably null 0.99
R7457:Olfr790 UTSW 10 129501706 missense probably damaging 1.00
R7782:Olfr790 UTSW 10 129501151 missense probably benign 0.01
R7969:Olfr790 UTSW 10 129501847 missense probably benign 0.14
R8512:Olfr790 UTSW 10 129501627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAAGTGTGACTGGGAACCTCATC -3'
(R):5'- CCTCTCCCTTGCAGAAGGCTTAATG -3'

Sequencing Primer
(F):5'- GTGACTGGGAACCTCATCATTATC -3'
(R):5'- CCATAAGAGAGGGAGACAACTATC -3'
Posted On2013-11-08