Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Myocd'

83806

Institutional Source

Beutler Lab

Gene Symbol

Myocd

Ensembl Gene

ENSMUSG00000020542

Gene Name

myocardin

Synonyms

Srfcp

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65176561-65269989 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 65195192 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 215 (P215L)

Ref Sequence

ENSEMBL: ENSMUSP00000098603 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101042
AA Change: P215L

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542
AA Change: P215L

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
SCOP:d1lsha3	140	221	4e-3	SMART
SAP	252	286	1.29e-8	SMART
low complexity region	326	343	N/A	INTRINSIC
low complexity region	371	383	N/A	INTRINSIC
coiled coil region	396	435	N/A	INTRINSIC
low complexity region	557	573	N/A	INTRINSIC
low complexity region	615	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102635
AA Change: P343L

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: P343L

Domain	Start	End	E-Value	Type
RPEL	18	43	4e-1	SMART
RPEL	62	87	9.26e0	SMART
RPEL	106	131	1.15e-6	SMART
low complexity region	147	160	N/A	INTRINSIC
low complexity region	247	260	N/A	INTRINSIC
SCOP:d1lsha3	268	349	4e-3	SMART
SAP	380	414	1.29e-8	SMART
low complexity region	454	471	N/A	INTRINSIC
low complexity region	499	511	N/A	INTRINSIC
coiled coil region	524	563	N/A	INTRINSIC
low complexity region	695	709	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108695
AA Change: P343L

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: P343L

Domain	Start	End	E-Value	Type
RPEL	18	43	4e-1	SMART
RPEL	62	87	9.26e0	SMART
RPEL	106	131	1.15e-6	SMART
low complexity region	147	160	N/A	INTRINSIC
low complexity region	247	260	N/A	INTRINSIC
SCOP:d1lsha3	268	349	5e-3	SMART
SAP	380	414	1.29e-8	SMART
low complexity region	454	471	N/A	INTRINSIC
low complexity region	499	511	N/A	INTRINSIC
coiled coil region	524	563	N/A	INTRINSIC
low complexity region	685	701	N/A	INTRINSIC
low complexity region	743	757	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144399

SMART Domains

Protein: ENSMUSP00000115572
Gene: ENSMUSG00000020542

Domain	Start	End	E-Value	Type
low complexity region	22	35	N/A	INTRINSIC
low complexity region	122	135	N/A	INTRINSIC
low complexity region	160	195	N/A	INTRINSIC

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Myocd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Myocd	APN	11	65180944	critical splice acceptor site	probably null
IGL00481:Myocd	APN	11	65187154	missense	probably damaging	0.99
IGL00857:Myocd	APN	11	65178836	missense	possibly damaging	0.93
IGL01012:Myocd	APN	11	65184625	missense	possibly damaging	0.51
IGL01570:Myocd	APN	11	65200807	missense	probably benign	0.00
IGL01865:Myocd	APN	11	65200897	missense	probably benign	0.30
IGL01938:Myocd	APN	11	65187088	missense	probably damaging	1.00
IGL02324:Myocd	APN	11	65178658	missense	probably benign	0.01
IGL02598:Myocd	APN	11	65183470	missense	probably benign	0.31
IGL02886:Myocd	APN	11	65178743	missense	probably damaging	0.99
IGL03008:Myocd	APN	11	65187566	missense	probably damaging	0.98
IGL03034:Myocd	APN	11	65218685	missense	probably benign	0.00
harvey	UTSW	11	65179030	splice site	probably null
irma	UTSW	11	65196394	missense	probably damaging	0.97
Nate	UTSW	11	65233088	splice site	probably null
R0078:Myocd	UTSW	11	65187464	missense	possibly damaging	0.96
R0097:Myocd	UTSW	11	65179014	missense	possibly damaging	0.67
R0097:Myocd	UTSW	11	65179014	missense	possibly damaging	0.67
R0234:Myocd	UTSW	11	65187240	missense	probably benign	0.01
R0234:Myocd	UTSW	11	65187240	missense	probably benign	0.01
R0453:Myocd	UTSW	11	65196225	missense	probably damaging	1.00
R0523:Myocd	UTSW	11	65180902	missense	probably damaging	1.00
R0838:Myocd	UTSW	11	65178932	missense	probably benign	0.00
R1167:Myocd	UTSW	11	65196377	missense	possibly damaging	0.77
R1472:Myocd	UTSW	11	65187504	missense	probably benign	0.01
R1508:Myocd	UTSW	11	65184516	missense	probably damaging	0.98
R1620:Myocd	UTSW	11	65196394	missense	probably damaging	0.97
R1630:Myocd	UTSW	11	65196394	missense	probably damaging	0.97
R1731:Myocd	UTSW	11	65200888	missense	probably benign	0.30
R1740:Myocd	UTSW	11	65218521	splice site	probably benign
R1769:Myocd	UTSW	11	65178701	missense	probably benign	0.01
R1823:Myocd	UTSW	11	65178670	missense	probably benign	0.00
R1968:Myocd	UTSW	11	65200907	missense	probably damaging	1.00
R1997:Myocd	UTSW	11	65204321	nonsense	probably null
R2018:Myocd	UTSW	11	65187028	missense	probably damaging	1.00
R2105:Myocd	UTSW	11	65218658	nonsense	probably null
R2314:Myocd	UTSW	11	65200807	missense	probably damaging	1.00
R4330:Myocd	UTSW	11	65223764	missense	probably benign	0.12
R4331:Myocd	UTSW	11	65223764	missense	probably benign	0.12
R4603:Myocd	UTSW	11	65187745	missense	possibly damaging	0.82
R4619:Myocd	UTSW	11	65178428	utr 3 prime	probably benign
R4631:Myocd	UTSW	11	65178859	missense	probably benign	0.10
R4865:Myocd	UTSW	11	65179030	splice site	probably null
R4974:Myocd	UTSW	11	65183473	missense	possibly damaging	0.78
R4976:Myocd	UTSW	11	65222050	missense	probably benign	0.00
R5478:Myocd	UTSW	11	65233088	splice site	probably null
R5499:Myocd	UTSW	11	65178749	missense	possibly damaging	0.62
R6052:Myocd	UTSW	11	65196256	missense	probably damaging	1.00
R6356:Myocd	UTSW	11	65218570	splice site	probably null
R7144:Myocd	UTSW	11	65218648	missense	probably damaging	1.00
R7261:Myocd	UTSW	11	65187596	missense	probably damaging	0.98
R7354:Myocd	UTSW	11	65187493	missense	probably benign	0.00
R7461:Myocd	UTSW	11	65218603	missense	probably damaging	1.00
R7613:Myocd	UTSW	11	65218603	missense	probably damaging	1.00
R7718:Myocd	UTSW	11	65218626	missense	probably damaging	1.00
R7956:Myocd	UTSW	11	65269668	missense	possibly damaging	0.50
R8345:Myocd	UTSW	11	65187132	nonsense	probably null
X0057:Myocd	UTSW	11	65183445	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AGCTTTATAAGTCGCACACCTTCCC -3'
(R):5'- GACTCCATCACGTCATTCAGTGTCC -3'

Sequencing Primer
(F):5'- GCACTGTAAATTCTGTGACACC -3'
(R):5'- CTAGATCACGTTATTGATTTCCCTC -3'

Posted On

2013-11-08