Incidental Mutation 'R0899:Fam120a'
ID83809
Institutional Source Beutler Lab
Gene Symbol Fam120a
Ensembl Gene ENSMUSG00000038014
Gene Namefamily with sequence similarity 120, member A
Synonyms
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0899 (G1)
Quality Score202
Status Not validated
Chromosome13
Chromosomal Location48879219-48968017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48885743 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 979 (A979E)
Ref Sequence ENSEMBL: ENSMUSP00000053877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060805]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060805
AA Change: A979E

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053877
Gene: ENSMUSG00000038014
AA Change: A979E

DomainStartEndE-ValueType
Blast:XPGN 1 112 1e-15 BLAST
low complexity region 348 361 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 881 897 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
low complexity region 972 986 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1026 1044 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Fam120a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Fam120a APN 13 48889133 missense probably benign
IGL01087:Fam120a APN 13 48902073 missense probably damaging 1.00
IGL02052:Fam120a APN 13 48933945 splice site probably benign
IGL02409:Fam120a APN 13 48967359 missense probably benign 0.05
IGL03172:Fam120a APN 13 48910336 missense probably damaging 1.00
bumped UTSW 13 48892021 missense probably benign 0.07
Green_flash UTSW 13 48891964 missense probably damaging 1.00
Sunset UTSW 13 48910250 splice site probably null
upended UTSW 13 48897667 missense probably damaging 1.00
R0036:Fam120a UTSW 13 48889264 splice site probably benign
R0042:Fam120a UTSW 13 48934014 missense probably damaging 1.00
R0689:Fam120a UTSW 13 48967638 missense probably damaging 1.00
R0741:Fam120a UTSW 13 48891940 missense possibly damaging 0.91
R0900:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0987:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0989:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0990:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1080:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1121:Fam120a UTSW 13 48910437 splice site probably null
R1265:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1423:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1611:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1755:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R2041:Fam120a UTSW 13 48897767 missense probably benign 0.01
R2433:Fam120a UTSW 13 48933968 missense probably damaging 1.00
R2496:Fam120a UTSW 13 48967593 missense probably damaging 0.99
R3122:Fam120a UTSW 13 48892086 missense possibly damaging 0.45
R4279:Fam120a UTSW 13 48889258 missense probably benign 0.00
R4758:Fam120a UTSW 13 48880857 missense probably benign 0.02
R4924:Fam120a UTSW 13 48902096 missense probably benign 0.04
R5000:Fam120a UTSW 13 48897667 missense probably damaging 1.00
R5039:Fam120a UTSW 13 48910250 splice site probably null
R5194:Fam120a UTSW 13 48880935 missense probably benign
R5772:Fam120a UTSW 13 48880933 missense probably benign
R6765:Fam120a UTSW 13 48891964 missense probably damaging 1.00
R6820:Fam120a UTSW 13 48880992 missense possibly damaging 0.51
R6833:Fam120a UTSW 13 48934041 missense probably damaging 1.00
R6895:Fam120a UTSW 13 48892021 missense probably benign 0.07
R6946:Fam120a UTSW 13 48881020 missense possibly damaging 0.83
R7032:Fam120a UTSW 13 48949113 missense probably benign 0.34
R7081:Fam120a UTSW 13 48910325 missense probably damaging 0.98
R7289:Fam120a UTSW 13 48892006 missense probably damaging 1.00
R7503:Fam120a UTSW 13 48949247 missense probably benign 0.00
R7978:Fam120a UTSW 13 48902274 missense probably damaging 1.00
R8200:Fam120a UTSW 13 48949119 missense probably damaging 0.97
R8311:Fam120a UTSW 13 48933957 missense possibly damaging 0.84
X0003:Fam120a UTSW 13 48949138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTGGAAATAACACCCCTTGGAC -3'
(R):5'- TGCATGGTGTGCTCAGAGAACC -3'

Sequencing Primer
(F):5'- GGTTCATACCCAAGGCATTTGAC -3'
(R):5'- tcttttttgttgttgttgtttgtttg -3'
Posted On2013-11-08