Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Ipo11'

83810

Institutional Source

Beutler Lab

Gene Symbol

Ipo11

Ensembl Gene

ENSMUSG00000042590

Gene Name

importin 11

Synonyms

Ranbp11, 1700081H05Rik, 2510001A17Rik, E330021B14Rik

MMRRC Submission

039059-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106794439-106936958 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to C at 106900816 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 173 (L173*)

Ref Sequence

ENSEMBL: ENSMUSP00000140046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080856] [ENSMUST00000186033]

Predicted Effect

probably null
Transcript: ENSMUST00000080856
AA Change: L173*

SMART Domains

Protein: ENSMUSP00000079667
Gene: ENSMUSG00000042590
AA Change: L173*

Domain	Start	End	E-Value	Type
IBN_N	28	100	7.71e-12	SMART
low complexity region	375	382	N/A	INTRINSIC
low complexity region	563	570	N/A	INTRINSIC
low complexity region	845	856	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186005

Predicted Effect

probably null
Transcript: ENSMUST00000186033
AA Change: L173*

SMART Domains

Protein: ENSMUSP00000140046
Gene: ENSMUSG00000042590
AA Change: L173*

Domain	Start	End	E-Value	Type
IBN_N	28	100	7.71e-12	SMART
low complexity region	375	382	N/A	INTRINSIC
low complexity region	563	570	N/A	INTRINSIC
low complexity region	854	865	N/A	INTRINSIC

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Importins, including IPO11, are a members of the karyopherin/importin-beta family of transport receptors (see KPNB1; 602738) that mediate nucleocytoplasmic transport of protein and RNA cargoes (Plafker and Macara, 2000 [PubMed 11032817]).[supplied by OMIM, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Cfap43	C	T	19: 47,747,994	G1353R	possibly damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Ipo11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Ipo11	APN	13	106897260	missense	probably damaging	1.00
IGL00900:Ipo11	APN	13	106847444	missense	possibly damaging	0.81
IGL00971:Ipo11	APN	13	106856769	missense	probably damaging	1.00
IGL01023:Ipo11	APN	13	106897259	missense	probably benign	0.44
IGL01331:Ipo11	APN	13	106795746	missense	possibly damaging	0.92
IGL01608:Ipo11	APN	13	106834494	intron	probably benign
IGL02021:Ipo11	APN	13	106857237	missense	probably damaging	1.00
IGL02620:Ipo11	APN	13	106876281	critical splice acceptor site	probably null
IGL02651:Ipo11	APN	13	106875606	missense	probably damaging	1.00
IGL02699:Ipo11	APN	13	106889397	missense	possibly damaging	0.94
IGL02928:Ipo11	APN	13	106889355	splice site	probably benign
R0017:Ipo11	UTSW	13	106886730	missense	probably benign	0.00
R0017:Ipo11	UTSW	13	106886730	missense	probably benign	0.00
R0032:Ipo11	UTSW	13	106834463	intron	probably benign
R0164:Ipo11	UTSW	13	106910194	splice site	probably benign
R0333:Ipo11	UTSW	13	106870763	missense	probably benign	0.00
R0499:Ipo11	UTSW	13	106925087	missense	probably benign	0.00
R0555:Ipo11	UTSW	13	106892461	missense	probably damaging	1.00
R0718:Ipo11	UTSW	13	106919611	missense	possibly damaging	0.91
R1590:Ipo11	UTSW	13	106886717	missense	probably damaging	1.00
R1700:Ipo11	UTSW	13	106795662	missense	probably benign
R1851:Ipo11	UTSW	13	106812257	missense	possibly damaging	0.73
R1852:Ipo11	UTSW	13	106812257	missense	possibly damaging	0.73
R1853:Ipo11	UTSW	13	106860887	missense	probably benign	0.19
R2012:Ipo11	UTSW	13	106919622	missense	probably benign	0.01
R2168:Ipo11	UTSW	13	106879610	splice site	probably null
R2183:Ipo11	UTSW	13	106925087	missense	probably benign	0.00
R4254:Ipo11	UTSW	13	106892509	missense	probably benign	0.00
R4607:Ipo11	UTSW	13	106900811	missense	probably damaging	0.98
R4610:Ipo11	UTSW	13	106879737	missense	probably benign	0.06
R4654:Ipo11	UTSW	13	106834184	intron	probably benign
R4792:Ipo11	UTSW	13	106834160	intron	probably benign
R4990:Ipo11	UTSW	13	106860887	missense	probably benign	0.19
R5309:Ipo11	UTSW	13	106833973	intron	probably benign
R5580:Ipo11	UTSW	13	106900747	missense	probably benign
R5822:Ipo11	UTSW	13	106848418	unclassified	probably benign
R6459:Ipo11	UTSW	13	106865769	splice site	probably null
R6597:Ipo11	UTSW	13	106865863	critical splice donor site	probably null
R6803:Ipo11	UTSW	13	106857258	missense	probably benign
R6882:Ipo11	UTSW	13	106900682	splice site	probably null
R7071:Ipo11	UTSW	13	106925096	missense	probably damaging	1.00
R7202:Ipo11	UTSW	13	106875570	missense	probably damaging	1.00
R7214:Ipo11	UTSW	13	106895857	missense	probably null
R7221:Ipo11	UTSW	13	106892557	missense	probably damaging	1.00
R7392:Ipo11	UTSW	13	106891691	nonsense	probably null
R7871:Ipo11	UTSW	13	106892468	missense	probably benign	0.01
R8189:Ipo11	UTSW	13	106925096	missense	probably damaging	1.00
R8426:Ipo11	UTSW	13	106842170	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GTGAGCAGATCAAGTTCAACAGTACCT -3'
(R):5'- TGTGGCATACTGAGTGATGGTCCATAA -3'

Sequencing Primer
(F):5'- CTTTTAACGATAGCAGTGTTCGC -3'
(R):5'- tccattacaaccattacaaccac -3'

Posted On

2013-11-08