Incidental Mutation 'R0899:Ipo11'
ID83810
Institutional Source Beutler Lab
Gene Symbol Ipo11
Ensembl Gene ENSMUSG00000042590
Gene Nameimportin 11
SynonymsRanbp11, 1700081H05Rik, 2510001A17Rik, E330021B14Rik
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location106794439-106936958 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 106900816 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 173 (L173*)
Ref Sequence ENSEMBL: ENSMUSP00000140046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080856] [ENSMUST00000186033]
Predicted Effect probably null
Transcript: ENSMUST00000080856
AA Change: L173*
SMART Domains Protein: ENSMUSP00000079667
Gene: ENSMUSG00000042590
AA Change: L173*

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186005
Predicted Effect probably null
Transcript: ENSMUST00000186033
AA Change: L173*
SMART Domains Protein: ENSMUSP00000140046
Gene: ENSMUSG00000042590
AA Change: L173*

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Importins, including IPO11, are a members of the karyopherin/importin-beta family of transport receptors (see KPNB1; 602738) that mediate nucleocytoplasmic transport of protein and RNA cargoes (Plafker and Macara, 2000 [PubMed 11032817]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Ipo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ipo11 APN 13 106897260 missense probably damaging 1.00
IGL00900:Ipo11 APN 13 106847444 missense possibly damaging 0.81
IGL00971:Ipo11 APN 13 106856769 missense probably damaging 1.00
IGL01023:Ipo11 APN 13 106897259 missense probably benign 0.44
IGL01331:Ipo11 APN 13 106795746 missense possibly damaging 0.92
IGL01608:Ipo11 APN 13 106834494 intron probably benign
IGL02021:Ipo11 APN 13 106857237 missense probably damaging 1.00
IGL02620:Ipo11 APN 13 106876281 critical splice acceptor site probably null
IGL02651:Ipo11 APN 13 106875606 missense probably damaging 1.00
IGL02699:Ipo11 APN 13 106889397 missense possibly damaging 0.94
IGL02928:Ipo11 APN 13 106889355 splice site probably benign
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0032:Ipo11 UTSW 13 106834463 intron probably benign
R0164:Ipo11 UTSW 13 106910194 splice site probably benign
R0333:Ipo11 UTSW 13 106870763 missense probably benign 0.00
R0499:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R0555:Ipo11 UTSW 13 106892461 missense probably damaging 1.00
R0718:Ipo11 UTSW 13 106919611 missense possibly damaging 0.91
R1590:Ipo11 UTSW 13 106886717 missense probably damaging 1.00
R1700:Ipo11 UTSW 13 106795662 missense probably benign
R1851:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1852:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1853:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R2012:Ipo11 UTSW 13 106919622 missense probably benign 0.01
R2168:Ipo11 UTSW 13 106879610 splice site probably null
R2183:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R4254:Ipo11 UTSW 13 106892509 missense probably benign 0.00
R4607:Ipo11 UTSW 13 106900811 missense probably damaging 0.98
R4610:Ipo11 UTSW 13 106879737 missense probably benign 0.06
R4654:Ipo11 UTSW 13 106834184 intron probably benign
R4792:Ipo11 UTSW 13 106834160 intron probably benign
R4990:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R5309:Ipo11 UTSW 13 106833973 intron probably benign
R5580:Ipo11 UTSW 13 106900747 missense probably benign
R5822:Ipo11 UTSW 13 106848418 unclassified probably benign
R6459:Ipo11 UTSW 13 106865769 splice site probably null
R6597:Ipo11 UTSW 13 106865863 critical splice donor site probably null
R6803:Ipo11 UTSW 13 106857258 missense probably benign
R6882:Ipo11 UTSW 13 106900682 splice site probably null
R7071:Ipo11 UTSW 13 106925096 missense probably damaging 1.00
R7202:Ipo11 UTSW 13 106875570 missense probably damaging 1.00
R7214:Ipo11 UTSW 13 106895857 missense probably null
R7221:Ipo11 UTSW 13 106892557 missense probably damaging 1.00
R7392:Ipo11 UTSW 13 106891691 nonsense probably null
R7871:Ipo11 UTSW 13 106892468 missense probably benign 0.01
R8189:Ipo11 UTSW 13 106925096 missense probably damaging 1.00
R8426:Ipo11 UTSW 13 106842170 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTGAGCAGATCAAGTTCAACAGTACCT -3'
(R):5'- TGTGGCATACTGAGTGATGGTCCATAA -3'

Sequencing Primer
(F):5'- CTTTTAACGATAGCAGTGTTCGC -3'
(R):5'- tccattacaaccattacaaccac -3'
Posted On2013-11-08