Incidental Mutation 'R0899:5031439G07Rik'
ID83813
Institutional Source Beutler Lab
Gene Symbol 5031439G07Rik
Ensembl Gene ENSMUSG00000036046
Gene NameRIKEN cDNA 5031439G07 gene
Synonyms
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0899 (G1)
Quality Score114
Status Not validated
Chromosome15
Chromosomal Location84943936-84988551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84949258 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 442 (K442E)
Ref Sequence ENSEMBL: ENSMUSP00000128699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047144] [ENSMUST00000165743]
Predicted Effect probably damaging
Transcript: ENSMUST00000047144
AA Change: K399E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037011
Gene: ENSMUSG00000036046
AA Change: K399E

DomainStartEndE-ValueType
Pfam:DUF2045 25 264 7.4e-123 PFAM
low complexity region 347 362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124308
Predicted Effect probably damaging
Transcript: ENSMUST00000165743
AA Change: K442E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128699
Gene: ENSMUSG00000036046
AA Change: K442E

DomainStartEndE-ValueType
Pfam:DUF2045 71 305 7.3e-103 PFAM
low complexity region 390 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in 5031439G07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:5031439G07Rik APN 15 84955819 missense probably damaging 1.00
IGL02752:5031439G07Rik APN 15 84955841 nonsense probably null
R0269:5031439G07Rik UTSW 15 84954000 missense possibly damaging 0.92
R1302:5031439G07Rik UTSW 15 84953276 missense probably damaging 1.00
R1442:5031439G07Rik UTSW 15 84955632 splice site probably benign
R1468:5031439G07Rik UTSW 15 84953144 missense probably damaging 1.00
R1468:5031439G07Rik UTSW 15 84953144 missense probably damaging 1.00
R2299:5031439G07Rik UTSW 15 84953285 missense possibly damaging 0.59
R5721:5031439G07Rik UTSW 15 84960597 missense probably damaging 1.00
R5912:5031439G07Rik UTSW 15 84955696 missense possibly damaging 0.84
R5971:5031439G07Rik UTSW 15 84987662 missense possibly damaging 0.65
R6131:5031439G07Rik UTSW 15 84960592 missense probably damaging 1.00
R6981:5031439G07Rik UTSW 15 84949597 nonsense probably null
R7173:5031439G07Rik UTSW 15 84949647 missense possibly damaging 0.93
R7220:5031439G07Rik UTSW 15 84953136 missense probably damaging 1.00
R7554:5031439G07Rik UTSW 15 84955485 missense probably damaging 1.00
R7956:5031439G07Rik UTSW 15 84950762 missense possibly damaging 0.83
R8218:5031439G07Rik UTSW 15 84955467 missense probably damaging 0.99
R8500:5031439G07Rik UTSW 15 84987635 missense probably benign
R8501:5031439G07Rik UTSW 15 84960523 missense probably damaging 1.00
Z1177:5031439G07Rik UTSW 15 84950642 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GGACCCACTGTGACAAGAACTCTG -3'
(R):5'- ATCCATGCATCTCCGTTGCTGG -3'

Sequencing Primer
(F):5'- AGGACGAGGCACTTCAGTTTG -3'
(R):5'- CTGGCATGGGAGGGTAGG -3'
Posted On2013-11-08