Incidental Mutation 'R0899:Adamts1'
ID83814
Institutional Source Beutler Lab
Gene Symbol Adamts1
Ensembl Gene ENSMUSG00000022893
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 1
SynonymsMETH1, ADAMTS-1, ADAM-TS1, METH-1
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location85793827-85803113 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 85798052 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 340 (R340*)
Ref Sequence ENSEMBL: ENSMUSP00000118471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023610] [ENSMUST00000125897]
Predicted Effect probably null
Transcript: ENSMUST00000023610
AA Change: R603*
SMART Domains Protein: ENSMUSP00000023610
Gene: ENSMUSG00000022893
AA Change: R603*

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 22 194 1.3e-27 PFAM
Pfam:Reprolysin_4 257 464 2.2e-9 PFAM
Pfam:Reprolysin_5 257 466 1.6e-14 PFAM
Pfam:Reprolysin 259 468 3.6e-22 PFAM
Pfam:Reprolysin_2 279 458 2.1e-10 PFAM
Pfam:Reprolysin_3 281 413 4.8e-14 PFAM
ACR 469 549 7.36e-8 SMART
TSP1 563 615 3.77e-14 SMART
Pfam:ADAM_spacer1 726 844 1.7e-35 PFAM
TSP1 858 911 1.22e-8 SMART
TSP1 912 968 1.2e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125897
AA Change: R340*
SMART Domains Protein: ENSMUSP00000118471
Gene: ENSMUSG00000022893
AA Change: R340*

DomainStartEndE-ValueType
Pfam:Reprolysin_4 1 201 2.3e-9 PFAM
Pfam:Reprolysin_5 1 203 8.8e-14 PFAM
Pfam:Reprolysin 1 205 5e-22 PFAM
Pfam:Reprolysin_2 16 195 8.6e-10 PFAM
Pfam:Reprolysin_3 19 150 4.2e-14 PFAM
ACR 206 286 7.36e-8 SMART
TSP1 300 352 3.77e-14 SMART
Pfam:ADAM_spacer1 463 581 3e-35 PFAM
TSP1 595 648 1.22e-8 SMART
TSP1 649 680 4.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138474
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family and preproprotein that is proteolytically processed to generate a mature protein product. This secreted protein product plays an important role in ovulation, likely through its cleavage of the extracellular matrix component versican. The encoded protein may enhance tumorigenesis in a mouse model of breast cancer. Homozygous knockout mice for this gene exhibit enhanced perinatal lethality, impaired growth and adipose tissue development, and impaired ovulation in females. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display growth retardation with adipose tissue malformation, impaired female fertility, enlarged renal calices and abnormal adrenal medullary architecture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Adamts1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Adamts1 APN 16 85795573 missense probably benign
IGL01753:Adamts1 APN 16 85802224 missense probably benign 0.00
IGL02238:Adamts1 APN 16 85795825 missense probably benign 0.01
IGL02655:Adamts1 APN 16 85802617 missense probably benign
gambler UTSW 16 85799609 nonsense probably null
sure_thing UTSW 16 85798544 missense probably damaging 1.00
PIT4466001:Adamts1 UTSW 16 85796691 nonsense probably null
R0114:Adamts1 UTSW 16 85799614 missense probably benign 0.10
R0135:Adamts1 UTSW 16 85798703 splice site probably benign
R0179:Adamts1 UTSW 16 85795465 missense probably benign 0.00
R0517:Adamts1 UTSW 16 85800353 missense possibly damaging 0.96
R0526:Adamts1 UTSW 16 85802372 missense probably benign
R0727:Adamts1 UTSW 16 85798648 missense possibly damaging 0.51
R1163:Adamts1 UTSW 16 85802637 missense probably benign 0.07
R1555:Adamts1 UTSW 16 85797888 missense probably benign 0.17
R1598:Adamts1 UTSW 16 85798511 nonsense probably null
R1643:Adamts1 UTSW 16 85796817 splice site probably benign
R1847:Adamts1 UTSW 16 85802226 missense possibly damaging 0.89
R2045:Adamts1 UTSW 16 85795976 missense probably damaging 1.00
R2093:Adamts1 UTSW 16 85802445 missense probably benign 0.23
R2966:Adamts1 UTSW 16 85796774 missense possibly damaging 0.94
R3937:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R3938:Adamts1 UTSW 16 85795619 missense possibly damaging 0.90
R4348:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4350:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4351:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4352:Adamts1 UTSW 16 85802346 missense probably benign 0.02
R4470:Adamts1 UTSW 16 85798516 missense possibly damaging 0.88
R4724:Adamts1 UTSW 16 85802505 missense probably benign 0.00
R4775:Adamts1 UTSW 16 85800390 nonsense probably null
R4972:Adamts1 UTSW 16 85795945 missense probably damaging 1.00
R5353:Adamts1 UTSW 16 85802608 missense probably benign 0.00
R5420:Adamts1 UTSW 16 85799609 nonsense probably null
R5551:Adamts1 UTSW 16 85797746 missense probably benign
R5574:Adamts1 UTSW 16 85799642 missense probably damaging 1.00
R5759:Adamts1 UTSW 16 85798048 missense possibly damaging 0.93
R5860:Adamts1 UTSW 16 85798544 missense probably damaging 1.00
R5910:Adamts1 UTSW 16 85802149 missense probably benign 0.00
R6240:Adamts1 UTSW 16 85802157 missense probably benign
R6473:Adamts1 UTSW 16 85799643 missense probably damaging 1.00
R6623:Adamts1 UTSW 16 85795637 missense probably benign 0.20
R6628:Adamts1 UTSW 16 85795825 missense probably benign 0.05
R7034:Adamts1 UTSW 16 85802746 unclassified probably benign
R7174:Adamts1 UTSW 16 85799172 missense probably benign 0.00
R7572:Adamts1 UTSW 16 85797741 missense possibly damaging 0.51
R7759:Adamts1 UTSW 16 85797795 missense probably damaging 1.00
R7808:Adamts1 UTSW 16 85800229 missense probably damaging 0.99
R7880:Adamts1 UTSW 16 85798052 nonsense probably null
R7985:Adamts1 UTSW 16 85798114 missense probably damaging 1.00
R7986:Adamts1 UTSW 16 85799547 missense probably damaging 1.00
R8118:Adamts1 UTSW 16 85795933 missense probably damaging 1.00
R8466:Adamts1 UTSW 16 85802512 missense probably benign 0.42
R8468:Adamts1 UTSW 16 85795556 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGAACGACGGCGATGATGTTCC -3'
(R):5'- AGACAAACTCCTCTACCTGTGTCCC -3'

Sequencing Primer
(F):5'- GATGATGTTCCCAGTTTCCAAC -3'
(R):5'- CCCGTAGTGGGACTATGAGATG -3'
Posted On2013-11-08