Incidental Mutation 'R0899:Gtf2a1l'
ID 83815
Institutional Source Beutler Lab
Gene Symbol Gtf2a1l
Ensembl Gene ENSMUSG00000024154
Gene Name general transcription factor IIA, 1-like
Synonyms Gtf2a1lf, 1700011N16Rik, Alf
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock # R0899 (G1)
Quality Score 131
Status Not validated
Chromosome 17
Chromosomal Location 88668660-88715152 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88668724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 5 (N5S)
Ref Sequence ENSEMBL: ENSMUSP00000124286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024970] [ENSMUST00000161481]
AlphaFold Q8R4I4
Predicted Effect probably benign
Transcript: ENSMUST00000024970
AA Change: N5S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000024970
Gene: ENSMUSG00000024154
AA Change: N5S

DomainStartEndE-ValueType
TFIIA 9 468 6.87e-202 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124286
Gene: ENSMUSG00000024154
AA Change: N5S

DomainStartEndE-ValueType
Pfam:TFIIA 9 76 3.2e-29 PFAM
Pfam:TFIIA 70 243 3e-13 PFAM
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Gtf2a1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gtf2a1l APN 17 88694295 missense probably damaging 1.00
IGL00928:Gtf2a1l APN 17 88694462 missense probably benign 0.09
IGL00974:Gtf2a1l APN 17 88714949 missense probably damaging 1.00
IGL01024:Gtf2a1l APN 17 88671291 missense probably damaging 1.00
IGL02429:Gtf2a1l APN 17 88668713 start codon destroyed probably null 0.61
IGL02658:Gtf2a1l APN 17 88668718 missense probably benign 0.01
IGL03377:Gtf2a1l APN 17 88711593 missense probably benign 0.03
R0848:Gtf2a1l UTSW 17 88694229 missense probably damaging 0.99
R1435:Gtf2a1l UTSW 17 88694315 missense probably damaging 1.00
R1716:Gtf2a1l UTSW 17 88694580 missense probably benign 0.06
R1861:Gtf2a1l UTSW 17 88714954 missense probably damaging 1.00
R2301:Gtf2a1l UTSW 17 88711472 missense probably benign
R2906:Gtf2a1l UTSW 17 88694655 missense possibly damaging 0.92
R4281:Gtf2a1l UTSW 17 88711637 missense possibly damaging 0.95
R4289:Gtf2a1l UTSW 17 88694456 missense probably damaging 0.98
R4771:Gtf2a1l UTSW 17 88690020 missense probably benign 0.23
R4904:Gtf2a1l UTSW 17 88690043 critical splice donor site probably null
R4941:Gtf2a1l UTSW 17 88714922 missense probably damaging 1.00
R5106:Gtf2a1l UTSW 17 88694645 missense possibly damaging 0.95
R6003:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6128:Gtf2a1l UTSW 17 88694658 missense probably null 0.94
R6246:Gtf2a1l UTSW 17 88671547 missense probably benign 0.09
R6481:Gtf2a1l UTSW 17 88711625 missense probably benign 0.09
R7344:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R7462:Gtf2a1l UTSW 17 88694138 missense possibly damaging 0.77
R8712:Gtf2a1l UTSW 17 88714923 missense probably damaging 1.00
R8849:Gtf2a1l UTSW 17 88694138 missense possibly damaging 0.77
R9178:Gtf2a1l UTSW 17 88668724 missense
R9407:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R9569:Gtf2a1l UTSW 17 88694520 missense not run
Predicted Primers PCR Primer
(F):5'- AGTTGGTTGTACGCCTTACCACAC -3'
(R):5'- ATTGAGGGAACCCTGCCTCTACAC -3'

Sequencing Primer
(F):5'- GCCTTACCACACCCGTG -3'
(R):5'- AAATGGAATCAGAGCCCCAC -3'
Posted On 2013-11-08