Incidental Mutation 'R0899:Osbpl1a'
ID83816
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Nameoxysterol binding protein-like 1A
SynonymsLOC328902, G430090F17Rik
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12755314-12941841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12757690 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 377 (S377G)
Ref Sequence ENSEMBL: ENSMUSP00000112895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000119512] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000191078] [ENSMUST00000150758] [ENSMUST00000186263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074352
AA Change: S890G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252
AA Change: S890G

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117361
AA Change: S377G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252
AA Change: S377G

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118313
AA Change: S377G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252
AA Change: S377G

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119043
AA Change: S377G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252
AA Change: S377G

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119512
AA Change: S498G

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252
AA Change: S498G

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121018
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121774
AA Change: S350G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252
AA Change: S350G

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121808
AA Change: S377G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252
AA Change: S377G

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121888
AA Change: S377G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252
AA Change: S377G

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145777
Predicted Effect probably benign
Transcript: ENSMUST00000191078
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150758
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186263
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12757626 missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 12905075 missense probably benign
IGL01450:Osbpl1a APN 18 12871095 missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 12933581 missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12763575 missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12756214 missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12766824 missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12841313 nonsense probably null
IGL02451:Osbpl1a APN 18 12914493 splice site probably benign
IGL02490:Osbpl1a APN 18 12882284 unclassified probably benign
IGL02884:Osbpl1a APN 18 12819578 nonsense probably null
R0084:Osbpl1a UTSW 18 12757612 missense probably benign 0.07
R0266:Osbpl1a UTSW 18 12871163 splice site probably null
R0565:Osbpl1a UTSW 18 12759444 missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 12882279 critical splice acceptor site probably null
R1330:Osbpl1a UTSW 18 12882194 critical splice donor site probably null
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1475:Osbpl1a UTSW 18 12757680 missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12758839 missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12788316 splice site probably null
R1930:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R1931:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12759400 missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 12871173 missense probably benign 0.06
R2504:Osbpl1a UTSW 18 12905031 missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12766899 missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 12871072 unclassified probably benign
R4306:Osbpl1a UTSW 18 12819595 missense probably benign
R4835:Osbpl1a UTSW 18 12768536 critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12763537 missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12762640 missense probably benign 0.12
R5224:Osbpl1a UTSW 18 12933696 missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12758853 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12841192 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12892262 missense probably benign 0.22
R5833:Osbpl1a UTSW 18 12788362 missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 12905081 missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12756261 missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12756224 missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12766963 missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12841253 nonsense probably null
R7154:Osbpl1a UTSW 18 12768592 missense probably benign 0.00
R7459:Osbpl1a UTSW 18 12933585 missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 12933600 missense probably benign 0.44
R7797:Osbpl1a UTSW 18 12882264 missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 12914521 missense probably benign 0.01
R8084:Osbpl1a UTSW 18 12905042 missense probably damaging 1.00
R8506:Osbpl1a UTSW 18 12768586 missense probably benign 0.02
X0027:Osbpl1a UTSW 18 12759503 missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 12906923 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGGAACAATGGTTACAGGTGACTC -3'
(R):5'- GACAGTGTCAGATGCCAACATCTCC -3'

Sequencing Primer
(F):5'- TAACCCCTGCGTTTGGAAAAG -3'
(R):5'- tccccacattagccttgaac -3'
Posted On2013-11-08