Incidental Mutation 'R0899:Cbln2'
ID83819
Institutional Source Beutler Lab
Gene Symbol Cbln2
Ensembl Gene ENSMUSG00000024647
Gene Namecerebellin 2 precursor protein
Synonyms6330593N19Rik
MMRRC Submission 039059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location86711110-86718283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86716752 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 217 (S217P)
Ref Sequence ENSEMBL: ENSMUSP00000126810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068423] [ENSMUST00000122079] [ENSMUST00000122464] [ENSMUST00000169470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068423
AA Change: S217P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068863
Gene: ENSMUSG00000024647
AA Change: S217P

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122079
AA Change: S217P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113695
Gene: ENSMUSG00000024647
AA Change: S217P

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122464
AA Change: S217P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113996
Gene: ENSMUSG00000024647
AA Change: S217P

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169470
AA Change: S217P

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126810
Gene: ENSMUSG00000024647
AA Change: S217P

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
C1Q 86 224 4.65e-61 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of secreted neuronal glycoproteins. The transcript is broadly expressed in the embryonic and adult brain with higher levels in some regions including the olfactory bulb, thalamus, and cerebral cortex. The protein can bind to presynaptic neurexins and induce synaptogenesis in cultured neurons. Null mutant mice are viable, fertile and do not display obvious neuroanatomical defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: No overt anatomical or neuroanatomical defects are observed in mice homozygous for deletion of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Cfap43 C T 19: 47,747,994 G1353R possibly damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Cbln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cbln2 APN 18 86716384 nonsense probably null
IGL01942:Cbln2 APN 18 86716325 missense probably benign 0.44
IGL02369:Cbln2 APN 18 86713354 missense probably damaging 1.00
IGL02983:Cbln2 APN 18 86713379 missense probably benign 0.07
R1778:Cbln2 UTSW 18 86713147 missense probably benign 0.11
R2004:Cbln2 UTSW 18 86716666 missense probably damaging 0.99
R5571:Cbln2 UTSW 18 86713148 missense probably benign
R7136:Cbln2 UTSW 18 86716672 missense probably damaging 1.00
R7257:Cbln2 UTSW 18 86716734 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTACCCGGTGATCTCTGCATTTG -3'
(R):5'- TCTGAGGGTCAGCAGCATCTATGTC -3'

Sequencing Primer
(F):5'- TCTGCATTTGCCGGAGAC -3'
(R):5'- GTCAGCAGCATCTATGTCATCAG -3'
Posted On2013-11-08