Mutagenetix > Incidental Mutations

Incidental Mutation 'R0899:Cfap43'

83820

Institutional Source

Beutler Lab

Gene Symbol

Cfap43

Ensembl Gene

ENSMUSG00000044948

Gene Name

cilia and flagella associated protein 43

Synonyms

4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96

MMRRC Submission

039059-MU

Accession Numbers

Genbank: NM_027559

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R0899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47737561-47919299 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 47747994 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 1353 (G1353R)

Ref Sequence

ENSEMBL: ENSMUSP00000125007 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160247]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160247
AA Change: G1353R

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948
AA Change: G1353R

Domain	Start	End	E-Value	Type
low complexity region	12	36	N/A	INTRINSIC
Blast:WD40	70	111	6e-7	BLAST
Blast:WD40	115	156	1e-5	BLAST
Blast:WD40	162	197	8e-10	BLAST
WD40	349	388	1.07e0	SMART
Blast:WD40	392	432	3e-13	BLAST
WD40	435	473	3.96e1	SMART
WD40	479	518	3.82e1	SMART
Blast:WD40	638	683	8e-17	BLAST
Blast:WD40	689	728	1e-17	BLAST
low complexity region	766	781	N/A	INTRINSIC
coiled coil region	855	886	N/A	INTRINSIC
coiled coil region	925	961	N/A	INTRINSIC
low complexity region	971	981	N/A	INTRINSIC
coiled coil region	1170	1224	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
low complexity region	1268	1279	N/A	INTRINSIC
low complexity region	1524	1529	N/A	INTRINSIC
coiled coil region	1652	1671	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161832

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162657

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	T	C	15: 84,949,258	K442E	probably damaging	Het
Adamts1	G	A	16: 85,798,052	R340*	probably null	Het
Afg3l2	T	C	18: 67,422,977	N428S	possibly damaging	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
Astn1	T	A	1: 158,511,109	C475*	probably null	Het
Atp2b1	G	A	10: 99,017,031		probably null	Het
Cbln2	T	C	18: 86,716,752	S217P	possibly damaging	Het
Ces2h	T	C	8: 105,014,550	L58P	probably damaging	Het
Crcp	A	G	5: 130,059,831	M91V	probably benign	Het
Cubn	A	G	2: 13,362,328	V1577A	possibly damaging	Het
Dthd1	A	G	5: 62,842,928	H531R	probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fat2	C	T	11: 55,256,225	G3982S	probably damaging	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Fcnb	T	A	2: 28,076,779	K247N	probably damaging	Het
Gm4763	C	T	7: 24,723,312	R112H	probably benign	Het
Gtf2a1l	A	G	17: 88,668,724	N5S	possibly damaging	Het
Htr3a	T	A	9: 48,901,452	D229V	possibly damaging	Het
Ipo11	A	C	13: 106,900,816	L173*	probably null	Het
Jam3	C	A	9: 27,098,957	G244W	probably damaging	Het
Mrpl52	C	T	14: 54,427,084	R12*	probably null	Het
Myo15	A	G	11: 60,477,185	Y257C	possibly damaging	Het
Myocd	G	A	11: 65,195,192	P215L	possibly damaging	Het
Ndst1	T	C	18: 60,707,882	T243A	probably benign	Het
Obox5	A	T	7: 15,758,875	T252S	probably benign	Het
Oit1	A	G	14: 8,364,863	I16T	probably damaging	Het
Olfr1026	A	G	2: 85,923,387	T40A	probably benign	Het
Olfr790	T	C	10: 129,501,432	F183L	probably damaging	Het
Olfr854	A	C	9: 19,566,547	V276G	probably damaging	Het
Osbpl1a	T	C	18: 12,757,690	S377G	possibly damaging	Het
Pfkl	A	G	10: 78,005,439		probably null	Het
Prdm16	A	T	4: 154,528,909	N20K	probably damaging	Het
Prkd1	A	G	12: 50,385,193	I589T	probably damaging	Het
Scnn1b	G	A	7: 121,917,715	G525S	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Ttn	A	G	2: 76,887,985		probably benign	Het
Wap	T	C	11: 6,636,725	T125A	probably benign	Het
Wdr86	C	T	5: 24,718,007	R229Q	probably benign	Het

Other mutations in Cfap43

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Cfap43	APN	19	47830475	missense	probably benign	0.08
IGL00325:Cfap43	APN	19	47823188	splice site	probably benign
IGL00918:Cfap43	APN	19	47896661	missense	probably damaging	1.00
IGL01402:Cfap43	APN	19	47795666	missense	probably benign	0.25
IGL01404:Cfap43	APN	19	47795666	missense	probably benign	0.25
IGL01656:Cfap43	APN	19	47751900	missense	possibly damaging	0.95
IGL01738:Cfap43	APN	19	47797185	missense	probably damaging	0.97
IGL02168:Cfap43	APN	19	47751923	splice site	probably benign
IGL02225:Cfap43	APN	19	47812177	missense	probably benign	0.00
IGL02308:Cfap43	APN	19	47748024	missense	probably benign
IGL02354:Cfap43	APN	19	47897413	nonsense	probably null
IGL02361:Cfap43	APN	19	47897413	nonsense	probably null
IGL03283:Cfap43	APN	19	47791412	splice site	probably benign
3-1:Cfap43	UTSW	19	47751855	missense	probably benign	0.02
IGL03046:Cfap43	UTSW	19	47815863	missense	probably damaging	1.00
PIT4495001:Cfap43	UTSW	19	47897302	missense	probably damaging	1.00
R0270:Cfap43	UTSW	19	47797203	splice site	probably benign
R0421:Cfap43	UTSW	19	47835575	missense	probably benign	0.00
R0433:Cfap43	UTSW	19	47825771	missense	probably benign	0.44
R0576:Cfap43	UTSW	19	47797140	missense	probably benign	0.00
R0646:Cfap43	UTSW	19	47763676	missense	probably benign	0.25
R0740:Cfap43	UTSW	19	47835804	missense	possibly damaging	0.95
R0836:Cfap43	UTSW	19	47815846	missense	probably benign	0.02
R1171:Cfap43	UTSW	19	47835711	missense	probably benign	0.03
R1271:Cfap43	UTSW	19	47739744	missense	probably benign	0.22
R1271:Cfap43	UTSW	19	47747948	missense	probably damaging	0.98
R1371:Cfap43	UTSW	19	47835606	missense	possibly damaging	0.95
R1469:Cfap43	UTSW	19	47896875	missense	probably damaging	1.00
R1541:Cfap43	UTSW	19	47763852	splice site	probably null
R1625:Cfap43	UTSW	19	47751088	missense	probably damaging	1.00
R1679:Cfap43	UTSW	19	47773114	missense	probably benign	0.00
R1690:Cfap43	UTSW	19	47751066	critical splice donor site	probably null
R1820:Cfap43	UTSW	19	47897216	missense	probably damaging	0.99
R1891:Cfap43	UTSW	19	47813941	missense	probably damaging	0.97
R1956:Cfap43	UTSW	19	47897210	missense	probably benign	0.19
R1958:Cfap43	UTSW	19	47897210	missense	probably benign	0.19
R2110:Cfap43	UTSW	19	47835758	missense	probably damaging	1.00
R2118:Cfap43	UTSW	19	47770438	missense	probably damaging	1.00
R2290:Cfap43	UTSW	19	47773135	missense	probably damaging	0.99
R3691:Cfap43	UTSW	19	47897073	missense	probably benign	0.01
R3765:Cfap43	UTSW	19	47835575	missense	probably benign	0.01
R3917:Cfap43	UTSW	19	47897750	missense	probably benign	0.00
R3924:Cfap43	UTSW	19	47797116	missense	probably benign	0.00
R3925:Cfap43	UTSW	19	47797116	missense	probably benign	0.00
R3947:Cfap43	UTSW	19	47765979	missense	probably benign	0.28
R4256:Cfap43	UTSW	19	47782405	missense	probably benign	0.06
R4385:Cfap43	UTSW	19	47797129	missense	probably benign	0.28
R4395:Cfap43	UTSW	19	47751913	missense	probably benign	0.00
R4405:Cfap43	UTSW	19	47739797	missense	possibly damaging	0.57
R4541:Cfap43	UTSW	19	47748015	missense	probably benign	0.02
R4583:Cfap43	UTSW	19	47837216	missense	probably null	0.99
R4690:Cfap43	UTSW	19	47747859	missense	probably benign	0.45
R4852:Cfap43	UTSW	19	47897111	missense	possibly damaging	0.87
R5185:Cfap43	UTSW	19	47780394	missense	probably benign	0.00
R5192:Cfap43	UTSW	19	47825925	missense	probably damaging	1.00
R5196:Cfap43	UTSW	19	47825925	missense	probably damaging	1.00
R5197:Cfap43	UTSW	19	47897372	missense	probably damaging	1.00
R5205:Cfap43	UTSW	19	47897548	missense	possibly damaging	0.76
R5425:Cfap43	UTSW	19	47896932	missense	possibly damaging	0.94
R5516:Cfap43	UTSW	19	47738209	splice site	probably null
R5644:Cfap43	UTSW	19	47795675	missense	possibly damaging	0.66
R5844:Cfap43	UTSW	19	47795696	missense	probably benign
R5901:Cfap43	UTSW	19	47897099	missense	probably damaging	0.97
R5910:Cfap43	UTSW	19	47780271	missense	possibly damaging	0.63
R5920:Cfap43	UTSW	19	47760896	missense	possibly damaging	0.88
R5963:Cfap43	UTSW	19	47745574	missense	probably benign	0.42
R6817:Cfap43	UTSW	19	47756085	missense	possibly damaging	0.88
R6974:Cfap43	UTSW	19	47785278	critical splice donor site	probably null
R7219:Cfap43	UTSW	19	47791473	missense	probably benign	0.02
R7270:Cfap43	UTSW	19	47739785	missense	possibly damaging	0.86
R7733:Cfap43	UTSW	19	47897993	missense	possibly damaging	0.75
R7995:Cfap43	UTSW	19	47898023	missense	probably damaging	1.00
R8013:Cfap43	UTSW	19	47773109	missense	probably damaging	0.99
R8176:Cfap43	UTSW	19	47795675	missense	probably benign	0.00
R8242:Cfap43	UTSW	19	47897369	missense	probably damaging	1.00
R8303:Cfap43	UTSW	19	47765835	nonsense	probably null
R8333:Cfap43	UTSW	19	47897326	nonsense	probably null
R8353:Cfap43	UTSW	19	47746647	missense	probably damaging	1.00
R8453:Cfap43	UTSW	19	47746647	missense	probably damaging	1.00
R8474:Cfap43	UTSW	19	47897924	missense	probably benign	0.32
R8478:Cfap43	UTSW	19	47776076	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTCCTGGATATACTGACAGGTGTGCTA -3'
(R):5'- CGGCCCTGAAGTGACAAAGGAAA -3'

Sequencing Primer
(F):5'- ATACTGACAGGTGTGCTATTTCC -3'
(R):5'- ggttggttggtttgtttgtttg -3'

Posted On

2013-11-08