Incidental Mutation 'R0899:Cfap43'
ID83820
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Namecilia and flagella associated protein 43
Synonyms4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96
MMRRC Submission 039059-MU
Accession Numbers

Genbank: NM_027559

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R0899 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47737561-47919299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47747994 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1353 (G1353R)
Ref Sequence ENSEMBL: ENSMUSP00000125007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160247
AA Change: G1353R

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948
AA Change: G1353R

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Blast:WD40 70 111 6e-7 BLAST
Blast:WD40 115 156 1e-5 BLAST
Blast:WD40 162 197 8e-10 BLAST
WD40 349 388 1.07e0 SMART
Blast:WD40 392 432 3e-13 BLAST
WD40 435 473 3.96e1 SMART
WD40 479 518 3.82e1 SMART
Blast:WD40 638 683 8e-17 BLAST
Blast:WD40 689 728 1e-17 BLAST
low complexity region 766 781 N/A INTRINSIC
coiled coil region 855 886 N/A INTRINSIC
coiled coil region 925 961 N/A INTRINSIC
low complexity region 971 981 N/A INTRINSIC
coiled coil region 1170 1224 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
low complexity region 1268 1279 N/A INTRINSIC
low complexity region 1524 1529 N/A INTRINSIC
coiled coil region 1652 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162657
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik T C 15: 84,949,258 K442E probably damaging Het
Adamts1 G A 16: 85,798,052 R340* probably null Het
Afg3l2 T C 18: 67,422,977 N428S possibly damaging Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
Astn1 T A 1: 158,511,109 C475* probably null Het
Atp2b1 G A 10: 99,017,031 probably null Het
Cbln2 T C 18: 86,716,752 S217P possibly damaging Het
Ces2h T C 8: 105,014,550 L58P probably damaging Het
Crcp A G 5: 130,059,831 M91V probably benign Het
Cubn A G 2: 13,362,328 V1577A possibly damaging Het
Dthd1 A G 5: 62,842,928 H531R probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fat2 C T 11: 55,256,225 G3982S probably damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Fcnb T A 2: 28,076,779 K247N probably damaging Het
Gm4763 C T 7: 24,723,312 R112H probably benign Het
Gtf2a1l A G 17: 88,668,724 N5S possibly damaging Het
Htr3a T A 9: 48,901,452 D229V possibly damaging Het
Ipo11 A C 13: 106,900,816 L173* probably null Het
Jam3 C A 9: 27,098,957 G244W probably damaging Het
Mrpl52 C T 14: 54,427,084 R12* probably null Het
Myo15 A G 11: 60,477,185 Y257C possibly damaging Het
Myocd G A 11: 65,195,192 P215L possibly damaging Het
Ndst1 T C 18: 60,707,882 T243A probably benign Het
Obox5 A T 7: 15,758,875 T252S probably benign Het
Oit1 A G 14: 8,364,863 I16T probably damaging Het
Olfr1026 A G 2: 85,923,387 T40A probably benign Het
Olfr790 T C 10: 129,501,432 F183L probably damaging Het
Olfr854 A C 9: 19,566,547 V276G probably damaging Het
Osbpl1a T C 18: 12,757,690 S377G possibly damaging Het
Pfkl A G 10: 78,005,439 probably null Het
Prdm16 A T 4: 154,528,909 N20K probably damaging Het
Prkd1 A G 12: 50,385,193 I589T probably damaging Het
Scnn1b G A 7: 121,917,715 G525S probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Ttn A G 2: 76,887,985 probably benign Het
Wap T C 11: 6,636,725 T125A probably benign Het
Wdr86 C T 5: 24,718,007 R229Q probably benign Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47830475 missense probably benign 0.08
IGL00325:Cfap43 APN 19 47823188 splice site probably benign
IGL00918:Cfap43 APN 19 47896661 missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01404:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01656:Cfap43 APN 19 47751900 missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47797185 missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47751923 splice site probably benign
IGL02225:Cfap43 APN 19 47812177 missense probably benign 0.00
IGL02308:Cfap43 APN 19 47748024 missense probably benign
IGL02354:Cfap43 APN 19 47897413 nonsense probably null
IGL02361:Cfap43 APN 19 47897413 nonsense probably null
IGL03283:Cfap43 APN 19 47791412 splice site probably benign
3-1:Cfap43 UTSW 19 47751855 missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47815863 missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47897302 missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47797203 splice site probably benign
R0421:Cfap43 UTSW 19 47835575 missense probably benign 0.00
R0433:Cfap43 UTSW 19 47825771 missense probably benign 0.44
R0576:Cfap43 UTSW 19 47797140 missense probably benign 0.00
R0646:Cfap43 UTSW 19 47763676 missense probably benign 0.25
R0740:Cfap43 UTSW 19 47835804 missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47815846 missense probably benign 0.02
R1171:Cfap43 UTSW 19 47835711 missense probably benign 0.03
R1271:Cfap43 UTSW 19 47739744 missense probably benign 0.22
R1271:Cfap43 UTSW 19 47747948 missense probably damaging 0.98
R1371:Cfap43 UTSW 19 47835606 missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47896875 missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47763852 splice site probably null
R1625:Cfap43 UTSW 19 47751088 missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47773114 missense probably benign 0.00
R1690:Cfap43 UTSW 19 47751066 critical splice donor site probably null
R1820:Cfap43 UTSW 19 47897216 missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47813941 missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R1958:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R2110:Cfap43 UTSW 19 47835758 missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47770438 missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47773135 missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47897073 missense probably benign 0.01
R3765:Cfap43 UTSW 19 47835575 missense probably benign 0.01
R3917:Cfap43 UTSW 19 47897750 missense probably benign 0.00
R3924:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3925:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3947:Cfap43 UTSW 19 47765979 missense probably benign 0.28
R4256:Cfap43 UTSW 19 47782405 missense probably benign 0.06
R4385:Cfap43 UTSW 19 47797129 missense probably benign 0.28
R4395:Cfap43 UTSW 19 47751913 missense probably benign 0.00
R4405:Cfap43 UTSW 19 47739797 missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47748015 missense probably benign 0.02
R4583:Cfap43 UTSW 19 47837216 missense probably null 0.99
R4690:Cfap43 UTSW 19 47747859 missense probably benign 0.45
R4852:Cfap43 UTSW 19 47897111 missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47780394 missense probably benign 0.00
R5192:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47897372 missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47897548 missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47896932 missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47738209 splice site probably null
R5644:Cfap43 UTSW 19 47795675 missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47795696 missense probably benign
R5901:Cfap43 UTSW 19 47897099 missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47780271 missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47760896 missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47745574 missense probably benign 0.42
R6817:Cfap43 UTSW 19 47756085 missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47785278 critical splice donor site probably null
R7219:Cfap43 UTSW 19 47791473 missense probably benign 0.02
R7270:Cfap43 UTSW 19 47739785 missense possibly damaging 0.86
R7733:Cfap43 UTSW 19 47897993 missense possibly damaging 0.75
R7995:Cfap43 UTSW 19 47898023 missense probably damaging 1.00
R8013:Cfap43 UTSW 19 47773109 missense probably damaging 0.99
R8176:Cfap43 UTSW 19 47795675 missense probably benign 0.00
R8242:Cfap43 UTSW 19 47897369 missense probably damaging 1.00
R8303:Cfap43 UTSW 19 47765835 nonsense probably null
R8333:Cfap43 UTSW 19 47897326 nonsense probably null
R8353:Cfap43 UTSW 19 47746647 missense probably damaging 1.00
R8453:Cfap43 UTSW 19 47746647 missense probably damaging 1.00
R8474:Cfap43 UTSW 19 47897924 missense probably benign 0.32
R8478:Cfap43 UTSW 19 47776076 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCCTGGATATACTGACAGGTGTGCTA -3'
(R):5'- CGGCCCTGAAGTGACAAAGGAAA -3'

Sequencing Primer
(F):5'- ATACTGACAGGTGTGCTATTTCC -3'
(R):5'- ggttggttggtttgtttgtttg -3'
Posted On2013-11-08