Mutagenetix > Incidental Mutation

Incidental Mutation 'R0900:Ift140'

83864

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0900 (G1)

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25035812 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 422 (I422N)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: I422N

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: I422N

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: I422N

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: I422N

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

probably benign
Transcript: ENSMUST00000156945
AA Change: I153N

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: I153N

Domain	Start	End	E-Value	Type
Blast:WD40	2	35	6e-12	BLAST
SCOP:d1erja_	19	131	5e-7	SMART
Blast:WD40	39	83	1e-24	BLAST
Blast:WD40	95	136	2e-18	BLAST

Coding Region Coverage

1x: 99.5%
3x: 99.1%
10x: 98.0%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	T	12: 118,940,624	F144I	probably damaging	Het
Als2cl	A	G	9: 110,890,428	R468G	possibly damaging	Het
Arsk	C	A	13: 76,098,457		probably benign	Het
Cacna1d	T	C	14: 30,111,082	H912R	probably damaging	Het
Ccr1	A	T	9: 123,964,334	V53D	possibly damaging	Het
Clec2d	G	A	6: 129,183,113	R30K	probably benign	Het
Col12a1	A	G	9: 79,684,253	V975A	possibly damaging	Het
Col4a1	AGCCAGGGATGCCAGG	AGCCAGG	8: 11,218,014		probably benign	Het
Cul7	T	C	17: 46,658,337	S907P	probably benign	Het
Depdc1b	A	T	13: 108,362,260	H159L	possibly damaging	Het
Dhx57	T	C	17: 80,275,582	H198R	probably benign	Het
Dpp7	T	C	2: 25,356,299	D10G	probably damaging	Het
Esp18	G	A	17: 39,408,132	M7I	possibly damaging	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fam167a	A	G	14: 63,452,379	T42A	probably damaging	Het
Gm973	A	G	1: 59,566,668	R553G	probably benign	Het
Jag1	CTTT	CTTTT	2: 137,090,882		probably null	Het
Limk2	A	G	11: 3,350,731	F204L	probably damaging	Het
Lmo7	A	G	14: 101,887,188	D361G	probably damaging	Het
Maats1	G	A	16: 38,336,402	S47L	possibly damaging	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Olfr589	T	A	7: 103,155,313	M145L	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcdh18	A	T	3: 49,756,803	F21Y	probably benign	Het
Pcna-ps2	T	A	19: 9,284,123	Y249N	probably damaging	Het
Prkce	A	T	17: 86,625,458	D622V	probably damaging	Het
Prss47	A	C	13: 65,049,394	V176G	possibly damaging	Het
Prss55	C	T	14: 64,077,178	R181H	probably benign	Het
Prtg	A	T	9: 72,844,943	I204L	probably benign	Het
Pura	T	C	18: 36,287,667	I169T	probably damaging	Het
Rttn	C	T	18: 89,101,691	T1750I	probably benign	Het
Slc25a26	T	A	6: 94,507,658	S60T	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tmem94	T	A	11: 115,791,978	C614S	probably benign	Het
Trim12a	T	C	7: 104,304,262	N214S	probably benign	Het
Ube3c	T	C	5: 29,601,346	Y329H	probably benign	Het
Ubxn2a	T	C	12: 4,902,257	K2E	probably damaging	Het
Unc80	A	T	1: 66,671,598	E2675D	probably benign	Het
Usf3	C	T	16: 44,215,958	P267L	probably benign	Het
Vmn1r129	A	T	7: 21,360,710	Y194*	probably null	Het
Zfp750	T	C	11: 121,512,981	E356G	probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGCCTGCCAGTCCACAATTCAC -3'
(R):5'- TGGATTAAGCTGCCTCCAAGTCCC -3'

Sequencing Primer
(F):5'- GGGGGCATCTAAATACTTCCTG -3'
(R):5'- CTGTTCTGAATTACACCAATGTCCAG -3'

Posted On

2013-11-08