Mutagenetix > Incidental Mutation

Incidental Mutation 'R0900:Dhx57'

83867

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R0900 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80275582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 198 (H198R)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

AlphaFold

Q6P5D3

Predicted Effect

probably benign
Transcript: ENSMUST00000038166
AA Change: H145R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: H145R

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000086555
AA Change: H198R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: H198R

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Coding Region Coverage

1x: 99.5%
3x: 99.1%
10x: 98.0%
20x: 96.7%

Validation Efficiency

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	T	12: 118,940,624	F144I	probably damaging	Het
Als2cl	A	G	9: 110,890,428	R468G	possibly damaging	Het
Arsk	C	A	13: 76,098,457		probably benign	Het
Cacna1d	T	C	14: 30,111,082	H912R	probably damaging	Het
Ccr1	A	T	9: 123,964,334	V53D	possibly damaging	Het
Clec2d	G	A	6: 129,183,113	R30K	probably benign	Het
Col12a1	A	G	9: 79,684,253	V975A	possibly damaging	Het
Col4a1	AGCCAGGGATGCCAGG	AGCCAGG	8: 11,218,014		probably benign	Het
Cul7	T	C	17: 46,658,337	S907P	probably benign	Het
Depdc1b	A	T	13: 108,362,260	H159L	possibly damaging	Het
Dpp7	T	C	2: 25,356,299	D10G	probably damaging	Het
Esp18	G	A	17: 39,408,132	M7I	possibly damaging	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fam167a	A	G	14: 63,452,379	T42A	probably damaging	Het
Gm973	A	G	1: 59,566,668	R553G	probably benign	Het
Ift140	T	A	17: 25,035,812	I422N	probably benign	Het
Jag1	CTTT	CTTTT	2: 137,090,882		probably null	Het
Limk2	A	G	11: 3,350,731	F204L	probably damaging	Het
Lmo7	A	G	14: 101,887,188	D361G	probably damaging	Het
Maats1	G	A	16: 38,336,402	S47L	possibly damaging	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Nup98	T	A	7: 102,160,716	T536S	probably damaging	Het
Olfr589	T	A	7: 103,155,313	M145L	probably benign	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcdh18	A	T	3: 49,756,803	F21Y	probably benign	Het
Pcna-ps2	T	A	19: 9,284,123	Y249N	probably damaging	Het
Prkce	A	T	17: 86,625,458	D622V	probably damaging	Het
Prss47	A	C	13: 65,049,394	V176G	possibly damaging	Het
Prss55	C	T	14: 64,077,178	R181H	probably benign	Het
Prtg	A	T	9: 72,844,943	I204L	probably benign	Het
Pura	T	C	18: 36,287,667	I169T	probably damaging	Het
Rttn	C	T	18: 89,101,691	T1750I	probably benign	Het
Slc25a26	T	A	6: 94,507,658	S60T	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tmem94	T	A	11: 115,791,978	C614S	probably benign	Het
Trim12a	T	C	7: 104,304,262	N214S	probably benign	Het
Ube3c	T	C	5: 29,601,346	Y329H	probably benign	Het
Ubxn2a	T	C	12: 4,902,257	K2E	probably damaging	Het
Unc80	A	T	1: 66,671,598	E2675D	probably benign	Het
Usf3	C	T	16: 44,215,958	P267L	probably benign	Het
Vmn1r129	A	T	7: 21,360,710	Y194*	probably null	Het
Zfp750	T	C	11: 121,512,981	E356G	probably benign	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
R9210:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9212:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9447:Dhx57	UTSW	17	80242094	missense	probably damaging	1.00
R9562:Dhx57	UTSW	17	80254388	missense	probably damaging	1.00
R9669:Dhx57	UTSW	17	80245701	missense	probably benign	0.09
R9717:Dhx57	UTSW	17	80275018	missense	probably damaging	1.00
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GACTTGAGAGCAAGCGTCTCTTCC -3'
(R):5'- TCACCCTTGGCAGTGCAGAAAC -3'

Sequencing Primer
(F):5'- AAGCGTCTCTTCCTGTCTCTG -3'
(R):5'- TATCATGACAGTGCCCGTAG -3'

Posted On

2013-11-08