Mutagenetix > Incidental Mutation

Incidental Mutation 'R0903:Cntn2'

83873

Institutional Source

Beutler Lab

Gene Symbol

Cntn2

Ensembl Gene

ENSMUSG00000053024

Gene Name

contactin 2

Synonyms

Tax, axonin, TAG1, TAG-1, D130012K04Rik

MMRRC Submission

039061-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R0903 (G1)

Quality Score

124

Status

Not validated

Chromosome

Chromosomal Location

132437163-132470989 bp(-) (GRCm39)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

CCAGCAGCAGCAGCAGCA to CCAGCAGCAGCAGCA at 132461422 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086521] [ENSMUST00000186530] [ENSMUST00000188943]

AlphaFold

Q61330

Predicted Effect

probably benign
Transcript: ENSMUST00000086521

SMART Domains

Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
IGc2	54	120	8.78e-9	SMART
IG	142	232	3.89e-1	SMART
IGc2	254	315	2.14e-21	SMART
IGc2	341	404	4.59e-12	SMART
IGc2	433	497	7.52e-8	SMART
IGc2	523	596	2.72e-5	SMART
FN3	610	696	2.72e-12	SMART
FN3	713	799	1.02e-2	SMART
FN3	815	899	5.27e-10	SMART
FN3	915	995	8.91e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186487

Predicted Effect

probably benign
Transcript: ENSMUST00000186530

Predicted Effect

probably benign
Transcript: ENSMUST00000188943

SMART Domains

Protein: ENSMUSP00000139795
Gene: ENSMUSG00000053024

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
PDB:2OM5\|A	36	103	9e-37	PDB
SCOP:d1cs6a1	36	103	2e-11	SMART
Blast:IGc2	54	103	1e-30	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190601

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. Mice lacking a functional copy of this gene exhibit epileptic seizures and elevated expression of A1 adenosine receptors. [provided by RefSeq, Sep 2016]
PHENOTYPE: Targeted mutation of this locus results in molecular abnormalities in the central nervous system. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap3	A	G	4: 135,965,687 (GRCm39)	N399S	probably benign	Het
Camk4	T	A	18: 33,315,383 (GRCm39)	F303L	probably benign	Het
Hmg20b	C	T	10: 81,184,329 (GRCm39)		probably null	Het
Itih5	G	A	2: 10,253,999 (GRCm39)	R750Q	probably benign	Het
Kif13a	T	C	13: 47,082,735 (GRCm39)	T35A	possibly damaging	Het
Klri2	A	G	6: 129,710,739 (GRCm39)	S127P	possibly damaging	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Mmp3	A	G	9: 7,445,994 (GRCm39)	M33V	probably benign	Het
Mycbp2	T	C	14: 103,513,293 (GRCm39)	H821R	probably damaging	Het
Mzf1	C	A	7: 12,786,698 (GRCm39)	R124L	possibly damaging	Het
Or4k35	T	A	2: 111,100,701 (GRCm39)	I4L	probably benign	Het
Or8c11	C	G	9: 38,290,097 (GRCm39)	L301V	probably benign	Het
Scrib	A	T	15: 75,938,704 (GRCm39)	W203R	possibly damaging	Het
Sspo	A	G	6: 48,432,242 (GRCm39)		probably null	Het
Ssx2ip	G	T	3: 146,136,732 (GRCm39)	V327L	probably benign	Het
Ugt2a3	A	T	5: 87,475,570 (GRCm39)	F354Y	probably benign	Het

Other mutations in Cntn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01106:Cntn2	APN	1	132,449,622 (GRCm39)	splice site	probably benign
IGL01137:Cntn2	APN	1	132,449,035 (GRCm39)	splice site	probably benign
IGL01339:Cntn2	APN	1	132,446,643 (GRCm39)	splice site	probably null
IGL01369:Cntn2	APN	1	132,443,843 (GRCm39)	missense	probably benign
IGL01572:Cntn2	APN	1	132,455,909 (GRCm39)	missense	probably damaging	1.00
IGL02389:Cntn2	APN	1	132,453,059 (GRCm39)	missense	probably damaging	0.99
IGL02473:Cntn2	APN	1	132,446,069 (GRCm39)	missense	probably benign
IGL02550:Cntn2	APN	1	132,456,801 (GRCm39)	missense	probably null	0.03
IGL02608:Cntn2	APN	1	132,453,654 (GRCm39)	missense	possibly damaging	0.87
IGL02755:Cntn2	APN	1	132,457,040 (GRCm39)	missense	probably benign	0.43
IGL02850:Cntn2	APN	1	132,446,114 (GRCm39)	missense	probably benign	0.00
IGL02887:Cntn2	APN	1	132,444,308 (GRCm39)	missense	probably damaging	0.96
IGL03060:Cntn2	APN	1	132,456,678 (GRCm39)	missense	probably benign	0.03
IGL03224:Cntn2	APN	1	132,450,780 (GRCm39)	missense	probably damaging	1.00
R0009:Cntn2	UTSW	1	132,443,918 (GRCm39)	nonsense	probably null
R0009:Cntn2	UTSW	1	132,443,918 (GRCm39)	nonsense	probably null
R0270:Cntn2	UTSW	1	132,449,462 (GRCm39)	missense	probably damaging	1.00
R0739:Cntn2	UTSW	1	132,456,750 (GRCm39)	missense	probably damaging	1.00
R0849:Cntn2	UTSW	1	132,450,124 (GRCm39)	missense	probably benign	0.09
R1463:Cntn2	UTSW	1	132,448,875 (GRCm39)	critical splice donor site	probably null
R1512:Cntn2	UTSW	1	132,451,430 (GRCm39)	missense	probably damaging	0.99
R1535:Cntn2	UTSW	1	132,453,122 (GRCm39)	missense	probably benign	0.26
R1686:Cntn2	UTSW	1	132,454,049 (GRCm39)	missense	possibly damaging	0.78
R1696:Cntn2	UTSW	1	132,449,017 (GRCm39)	missense	probably damaging	0.96
R1708:Cntn2	UTSW	1	132,446,936 (GRCm39)	missense	probably damaging	0.96
R2251:Cntn2	UTSW	1	132,453,059 (GRCm39)	missense	probably damaging	0.99
R2315:Cntn2	UTSW	1	132,450,735 (GRCm39)	missense	probably benign	0.00
R2395:Cntn2	UTSW	1	132,454,110 (GRCm39)	missense	probably benign
R3617:Cntn2	UTSW	1	132,456,361 (GRCm39)	missense	probably benign	0.16
R3883:Cntn2	UTSW	1	132,456,677 (GRCm39)	missense	probably damaging	0.99
R3884:Cntn2	UTSW	1	132,456,677 (GRCm39)	missense	probably damaging	0.99
R4060:Cntn2	UTSW	1	132,453,634 (GRCm39)	missense	probably damaging	0.99
R4289:Cntn2	UTSW	1	132,455,481 (GRCm39)	missense	probably benign	0.01
R4710:Cntn2	UTSW	1	132,455,963 (GRCm39)	missense	possibly damaging	0.84
R4921:Cntn2	UTSW	1	132,443,770 (GRCm39)	missense	possibly damaging	0.49
R5121:Cntn2	UTSW	1	132,444,798 (GRCm39)	nonsense	probably null
R5288:Cntn2	UTSW	1	132,451,415 (GRCm39)	missense	probably benign	0.18
R5360:Cntn2	UTSW	1	132,446,595 (GRCm39)	missense	probably damaging	0.97
R5787:Cntn2	UTSW	1	132,450,797 (GRCm39)	missense	probably damaging	1.00
R5817:Cntn2	UTSW	1	132,446,486 (GRCm39)	missense	probably benign	0.21
R5930:Cntn2	UTSW	1	132,451,170 (GRCm39)	missense	probably damaging	1.00
R6053:Cntn2	UTSW	1	132,446,090 (GRCm39)	missense	probably benign	0.18
R7189:Cntn2	UTSW	1	132,444,824 (GRCm39)	missense	probably damaging	1.00
R7352:Cntn2	UTSW	1	132,450,137 (GRCm39)	missense	probably benign	0.02
R7562:Cntn2	UTSW	1	132,454,055 (GRCm39)	missense	possibly damaging	0.67
R7689:Cntn2	UTSW	1	132,443,882 (GRCm39)	missense	probably benign	0.00
R7764:Cntn2	UTSW	1	132,450,101 (GRCm39)	missense	probably benign	0.21
R8080:Cntn2	UTSW	1	132,449,536 (GRCm39)	missense	probably damaging	1.00
R8344:Cntn2	UTSW	1	132,449,512 (GRCm39)	missense	probably damaging	1.00
R8683:Cntn2	UTSW	1	132,450,731 (GRCm39)	missense	probably damaging	1.00
R9087:Cntn2	UTSW	1	132,453,108 (GRCm39)	missense	probably damaging	1.00
R9188:Cntn2	UTSW	1	132,443,276 (GRCm39)	missense	probably damaging	1.00
R9267:Cntn2	UTSW	1	132,449,021 (GRCm39)	missense	probably benign	0.02
R9329:Cntn2	UTSW	1	132,456,678 (GRCm39)	missense	probably benign	0.03
R9385:Cntn2	UTSW	1	132,455,912 (GRCm39)	missense	probably damaging	1.00
X0018:Cntn2	UTSW	1	132,461,422 (GRCm39)	small deletion	probably benign
Z1176:Cntn2	UTSW	1	132,455,526 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATGGAGATCTGGCTTTGCCAC -3'
(R):5'- TCTACAGCCCAGGCAGTTCCTAAC -3'

Sequencing Primer
(F):5'- GGCTTTGCCACATTGTGC -3'
(R):5'- GGCAGTTCCTAACCAGATGTG -3'

Posted On

2013-11-08