Incidental Mutation 'R0903:Ssx2ip'
ID83877
Institutional Source Beutler Lab
Gene Symbol Ssx2ip
Ensembl Gene ENSMUSG00000036825
Gene Namesynovial sarcoma, X 2 interacting protein
SynonymsAdip
MMRRC Submission 039061-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0903 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146404642-146440144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 146430977 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 327 (V327L)
Ref Sequence ENSEMBL: ENSMUSP00000101759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039021] [ENSMUST00000106149] [ENSMUST00000106151] [ENSMUST00000106153]
Predicted Effect probably benign
Transcript: ENSMUST00000039021
AA Change: V327L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045663
Gene: ENSMUSG00000036825
AA Change: V327L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106149
AA Change: V327L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101755
Gene: ENSMUSG00000036825
AA Change: V327L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106151
AA Change: V327L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101757
Gene: ENSMUSG00000036825
AA Change: V327L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 8.5e-51 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 411 N/A INTRINSIC
low complexity region 425 435 N/A INTRINSIC
Blast:LPD_N 439 480 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106153
AA Change: V327L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101759
Gene: ENSMUSG00000036825
AA Change: V327L

DomainStartEndE-ValueType
Pfam:ADIP 63 214 1.2e-47 PFAM
coiled coil region 266 291 N/A INTRINSIC
coiled coil region 374 410 N/A INTRINSIC
low complexity region 426 436 N/A INTRINSIC
Blast:LPD_N 440 481 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141103
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the cancer-testis antigen Synovial Sarcoma X breakpoint 2 protein. The encoded protein may regulate the activity of Synovial Sarcoma X breakpoint 2 protein in malignant cells. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A G 4: 136,238,376 N399S probably benign Het
Camk4 T A 18: 33,182,330 F303L probably benign Het
Cntn2 CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA 1: 132,533,684 probably benign Het
Hmg20b C T 10: 81,348,495 probably null Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Kif13a T C 13: 46,929,259 T35A possibly damaging Het
Klri2 A G 6: 129,733,776 S127P possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mmp3 A G 9: 7,445,994 M33V probably benign Het
Mycbp2 T C 14: 103,275,857 H821R probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr1277 T A 2: 111,270,356 I4L probably benign Het
Olfr251 C G 9: 38,378,801 L301V probably benign Het
Scrib A T 15: 76,066,855 W203R possibly damaging Het
Sspo A G 6: 48,455,308 probably null Het
Ugt2a3 A T 5: 87,327,711 F354Y probably benign Het
Other mutations in Ssx2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Ssx2ip APN 3 146436552 missense probably damaging 1.00
IGL01140:Ssx2ip APN 3 146427843 missense probably benign 0.02
IGL01810:Ssx2ip APN 3 146428010 missense probably benign 0.00
R0432:Ssx2ip UTSW 3 146426429 missense probably damaging 1.00
R2228:Ssx2ip UTSW 3 146417776 missense probably damaging 0.98
R3151:Ssx2ip UTSW 3 146418383 missense probably benign 0.00
R4348:Ssx2ip UTSW 3 146432490 missense probably benign 0.01
R4446:Ssx2ip UTSW 3 146426431 missense probably benign 0.31
R4796:Ssx2ip UTSW 3 146418359 missense probably benign 0.02
R5054:Ssx2ip UTSW 3 146430917 splice site probably benign
R5338:Ssx2ip UTSW 3 146436541 critical splice acceptor site probably null
R5520:Ssx2ip UTSW 3 146437311 missense probably benign 0.03
R5898:Ssx2ip UTSW 3 146427831 missense possibly damaging 0.94
R6367:Ssx2ip UTSW 3 146419166 missense probably benign 0.16
R6777:Ssx2ip UTSW 3 146438721 missense possibly damaging 0.88
R7082:Ssx2ip UTSW 3 146430948 missense probably benign 0.01
R7239:Ssx2ip UTSW 3 146428016 missense probably damaging 1.00
R7249:Ssx2ip UTSW 3 146426438 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGAGAGACGCAACTCAGATCCCAG -3'
(R):5'- CAACACTAGACTATGGGCGACACTG -3'

Sequencing Primer
(F):5'- ACTTTGTGGCAGTATTCAGCAC -3'
(R):5'- CTATGGGCGACACTGTTCTCTAAG -3'
Posted On2013-11-08