Incidental Mutation 'R0903:Olfr251'
ID83885
Institutional Source Beutler Lab
Gene Symbol Olfr251
Ensembl Gene ENSMUSG00000096757
Gene Nameolfactory receptor 251
SynonymsMOR170-15, GA_x6K02T2MYUG-9124-8183
MMRRC Submission 039061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0903 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38377086-38382474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 38378801 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 301 (L301V)
Ref Sequence ENSEMBL: ENSMUSP00000149583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072731] [ENSMUST00000214865]
Predicted Effect probably benign
Transcript: ENSMUST00000072731
AA Change: L307V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072514
Gene: ENSMUSG00000096757
AA Change: L307V

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 9.8e-50 PFAM
Pfam:7tm_1 47 296 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214865
AA Change: L301V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A G 4: 136,238,376 N399S probably benign Het
Camk4 T A 18: 33,182,330 F303L probably benign Het
Cntn2 CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA 1: 132,533,684 probably benign Het
Hmg20b C T 10: 81,348,495 probably null Het
Itih5 G A 2: 10,249,188 R750Q probably benign Het
Kif13a T C 13: 46,929,259 T35A possibly damaging Het
Klri2 A G 6: 129,733,776 S127P possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mmp3 A G 9: 7,445,994 M33V probably benign Het
Mycbp2 T C 14: 103,275,857 H821R probably damaging Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr1277 T A 2: 111,270,356 I4L probably benign Het
Scrib A T 15: 76,066,855 W203R possibly damaging Het
Sspo A G 6: 48,455,308 probably null Het
Ssx2ip G T 3: 146,430,977 V327L probably benign Het
Ugt2a3 A T 5: 87,327,711 F354Y probably benign Het
Other mutations in Olfr251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02013:Olfr251 APN 9 38378077 missense probably benign 0.31
IGL02131:Olfr251 APN 9 38377907 missense probably benign 0.01
IGL02311:Olfr251 APN 9 38377898 nonsense probably null
IGL02377:Olfr251 APN 9 38378246 missense probably damaging 1.00
R0284:Olfr251 UTSW 9 38378584 missense probably benign 0.00
R0412:Olfr251 UTSW 9 38378794 missense probably damaging 0.98
R1664:Olfr251 UTSW 9 38378252 missense possibly damaging 0.93
R2902:Olfr251 UTSW 9 38378041 missense possibly damaging 0.89
R3970:Olfr251 UTSW 9 38377926 missense probably damaging 0.98
R4191:Olfr251 UTSW 9 38378352 missense probably damaging 0.98
R4650:Olfr251 UTSW 9 38378403 missense probably damaging 1.00
R4910:Olfr251 UTSW 9 38378742 missense probably null 0.98
R5256:Olfr251 UTSW 9 38377917 missense probably benign 0.00
R5385:Olfr251 UTSW 9 38377985 missense probably benign
R5386:Olfr251 UTSW 9 38377985 missense probably benign
R6005:Olfr251 UTSW 9 38378309 missense probably damaging 1.00
R6268:Olfr251 UTSW 9 38378088 missense probably benign 0.10
R6486:Olfr251 UTSW 9 38377904 missense probably benign
R7019:Olfr251 UTSW 9 38378802 missense possibly damaging 0.89
R7045:Olfr251 UTSW 9 38378433 missense probably damaging 0.99
R7120:Olfr251 UTSW 9 38378649 missense probably damaging 1.00
R7329:Olfr251 UTSW 9 38378160 missense probably benign 0.00
R7703:Olfr251 UTSW 9 38378061 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAAAGCCCTGGGCACTTGTG -3'
(R):5'- TGGCAGTGATCAACATTCTGGAGC -3'

Sequencing Primer
(F):5'- GGGTCCCACATCATAACTGTTAG -3'
(R):5'- GTGATCAACATTCTGGAGCAATATG -3'
Posted On2013-11-08