Incidental Mutation 'R0967:Camk1g'
ID83892
Institutional Source Beutler Lab
Gene Symbol Camk1g
Ensembl Gene ENSMUSG00000016179
Gene Namecalcium/calmodulin-dependent protein kinase I gamma
SynonymsCLICK-III, CaMKIgamma
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R0967 (G1)
Quality Score193
Status Validated
Chromosome1
Chromosomal Location193346346-193370298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 193350296 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 269 (E269G)
Ref Sequence ENSEMBL: ENSMUSP00000016323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016323] [ENSMUST00000169907]
Predicted Effect probably damaging
Transcript: ENSMUST00000016323
AA Change: E269G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016323
Gene: ENSMUSG00000016179
AA Change: E269G

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163202
AA Change: E229G
SMART Domains Protein: ENSMUSP00000131451
Gene: ENSMUSG00000016179
AA Change: E229G

DomainStartEndE-ValueType
S_TKc 2 238 5.19e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165718
Predicted Effect possibly damaging
Transcript: ENSMUST00000169907
AA Change: E269G

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128143
Gene: ENSMUSG00000016179
AA Change: E269G

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to calcium/calmodulin dependent protein kinase, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Camk1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Camk1g APN 1 193347349 unclassified probably benign
IGL02637:Camk1g APN 1 193348388 missense probably benign 0.38
I2288:Camk1g UTSW 1 193351106 splice site probably benign
R0375:Camk1g UTSW 1 193356401 splice site probably benign
R0433:Camk1g UTSW 1 193354058 missense probably damaging 0.99
R1161:Camk1g UTSW 1 193348354 missense probably benign
R1227:Camk1g UTSW 1 193347433 missense possibly damaging 0.73
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1641:Camk1g UTSW 1 193356357 missense probably benign 0.25
R3109:Camk1g UTSW 1 193354993 missense probably damaging 1.00
R3160:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3161:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R4638:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4642:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4644:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4756:Camk1g UTSW 1 193362085 missense probably benign 0.03
R4781:Camk1g UTSW 1 193356344 missense probably benign 0.00
R4987:Camk1g UTSW 1 193348475 missense probably damaging 0.99
R5224:Camk1g UTSW 1 193355034 missense probably damaging 1.00
R5407:Camk1g UTSW 1 193347372 unclassified probably null
R5932:Camk1g UTSW 1 193354039 missense probably benign 0.25
R6725:Camk1g UTSW 1 193350320 missense possibly damaging 0.80
R7071:Camk1g UTSW 1 193359809 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGGATGGCTAAACACGCTAGGCAC -3'
(R):5'- TGGCATGACGTAACTGGCAAGG -3'

Sequencing Primer
(F):5'- GAAGATAGAACCCTTGGCCTTTG -3'
(R):5'- GTAACTGGCAAGGCTCCC -3'
Posted On2013-11-08