Incidental Mutation 'R0967:Vmn2r51'
ID83906
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Namevomeronasal 2, receptor 51
Synonyms
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10087198-10105659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10100085 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 342 (H342P)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: H342P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: H342P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 10102414 missense probably benign
IGL01574:Vmn2r51 APN 7 10102454 missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 10100227 missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 10105482 missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 10100316 missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 10098119 splice site probably benign
IGL02834:Vmn2r51 APN 7 10098136 nonsense probably null
R0617:Vmn2r51 UTSW 7 10100469 missense possibly damaging 0.65
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 10102445 missense possibly damaging 0.58
R1559:Vmn2r51 UTSW 7 10102446 missense possibly damaging 0.87
R1598:Vmn2r51 UTSW 7 10105505 missense probably benign
R1754:Vmn2r51 UTSW 7 10099946 missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 10098163 nonsense probably null
R1836:Vmn2r51 UTSW 7 10098164 nonsense probably null
R3151:Vmn2r51 UTSW 7 10100041 missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 10102414 missense probably benign
R4933:Vmn2r51 UTSW 7 10098320 missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 10088005 missense probably benign
R5050:Vmn2r51 UTSW 7 10100422 missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 10102618 missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 10092201 missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 10105631 missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 10087994 missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 10098237 missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 10098216 missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 10102583 missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 10098264 missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 10100098 missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 10100553 missense probably null 1.00
R7246:Vmn2r51 UTSW 7 10102501 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGCCTGTTGCAGATTCATCTCG -3'
(R):5'- CTTCAGAATGTTGGACCCTCCCAC -3'

Sequencing Primer
(F):5'- CAGATTCATCTCGTGGAGGGC -3'
(R):5'- CCTCCCACTTTACAGAGAATATGG -3'
Posted On2013-11-08