Incidental Mutation 'R0967:Ccrl2'
ID83913
Institutional Source Beutler Lab
Gene Symbol Ccrl2
Ensembl Gene ENSMUSG00000043953
Gene Namechemokine (C-C motif) receptor-like 2
SynonymsCCR11, Cmkbr1l2, L-CCR
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111054486-111057519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111055686 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 248 (T248M)
Ref Sequence ENSEMBL: ENSMUSP00000143116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111888] [ENSMUST00000195968] [ENSMUST00000199839]
Predicted Effect probably benign
Transcript: ENSMUST00000111888
AA Change: T248M

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107519
Gene: ENSMUSG00000043953
AA Change: T248M

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195968
SMART Domains Protein: ENSMUSP00000143105
Gene: ENSMUSG00000043953

DomainStartEndE-ValueType
Pfam:7tm_1 54 130 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197851
Predicted Effect probably benign
Transcript: ENSMUST00000199839
AA Change: T248M

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000143116
Gene: ENSMUSG00000043953
AA Change: T248M

DomainStartEndE-ValueType
Pfam:7tm_1 54 304 4.2e-31 PFAM
Meta Mutation Damage Score 0.1676 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Ccrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02382:Ccrl2 APN 9 111055879 missense probably benign 0.22
IGL02492:Ccrl2 APN 9 111055803 missense probably benign 0.01
octomom UTSW 9 111055987 unclassified probably null
IGL03134:Ccrl2 UTSW 9 111055657 missense probably damaging 1.00
R0321:Ccrl2 UTSW 9 111056211 missense probably damaging 0.97
R0924:Ccrl2 UTSW 9 111055968 missense probably benign 0.39
R2033:Ccrl2 UTSW 9 111055870 missense possibly damaging 0.95
R3720:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R3721:Ccrl2 UTSW 9 111056364 missense probably benign 0.01
R4244:Ccrl2 UTSW 9 111055354 missense probably benign 0.33
R5634:Ccrl2 UTSW 9 111055987 unclassified probably null
R7027:Ccrl2 UTSW 9 111055885 missense probably benign 0.11
R7060:Ccrl2 UTSW 9 111055614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATATCATTGCACCGTGGGAAC -3'
(R):5'- ACTTCTTGCCAATCGAAGCGCC -3'

Sequencing Primer
(F):5'- CTTCCGGTCAAGAAGCAAATAG -3'
(R):5'- CCGCTCTGGAAGTACGTTC -3'
Posted On2013-11-08