Incidental Mutation 'R0967:Plagl1'
ID83914
Institutional Source Beutler Lab
Gene Symbol Plagl1
Ensembl Gene ENSMUSG00000019817
Gene Namepleiomorphic adenoma gene-like 1
SynonymsZac1
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location13060504-13131694 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 13128242 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121325] [ENSMUST00000121646] [ENSMUST00000121766] [ENSMUST00000130313] [ENSMUST00000143582] [ENSMUST00000145103] [ENSMUST00000193426]
Predicted Effect unknown
Transcript: ENSMUST00000121325
AA Change: F418S
SMART Domains Protein: ENSMUSP00000112889
Gene: ENSMUSG00000019817
AA Change: F418S

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121646
AA Change: F418S
SMART Domains Protein: ENSMUSP00000112847
Gene: ENSMUSG00000019817
AA Change: F418S

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121766
AA Change: F418S
SMART Domains Protein: ENSMUSP00000113710
Gene: ENSMUSG00000019817
AA Change: F418S

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126880
Predicted Effect probably benign
Transcript: ENSMUST00000130313
SMART Domains Protein: ENSMUSP00000117321
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141068
Predicted Effect probably benign
Transcript: ENSMUST00000143582
Predicted Effect probably benign
Transcript: ENSMUST00000145103
Predicted Effect probably benign
Transcript: ENSMUST00000193426
SMART Domains Protein: ENSMUSP00000141514
Gene: ENSMUSG00000019817

DomainStartEndE-ValueType
ZnF_C2H2 4 26 1e-4 SMART
ZnF_C2H2 32 56 3.2e-6 SMART
ZnF_C2H2 62 84 1.3e-5 SMART
ZnF_C2H2 91 113 1.1e-4 SMART
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice exhibit significantly reduced birth weights. Heterozygous mice with a paternal copy of the null allele show reduced fetal and birth weights, altered ossification, dyspnea and background-dependent neonatal lethality, as well as wrinkled skin and curly tails with 30% penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Plagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Plagl1 APN 10 13127872 unclassified probably benign
R0554:Plagl1 UTSW 10 13127182 missense probably benign 0.07
R0842:Plagl1 UTSW 10 13128554 unclassified probably benign
R1610:Plagl1 UTSW 10 13128962 unclassified probably benign
R2002:Plagl1 UTSW 10 13128658 unclassified probably benign
R2107:Plagl1 UTSW 10 13128647 unclassified probably benign
R2108:Plagl1 UTSW 10 13128647 unclassified probably benign
R2191:Plagl1 UTSW 10 13128941 unclassified probably benign
R4061:Plagl1 UTSW 10 13128771 unclassified probably benign
R4062:Plagl1 UTSW 10 13128771 unclassified probably benign
R4631:Plagl1 UTSW 10 13127999 unclassified probably benign
R4924:Plagl1 UTSW 10 13127557 missense possibly damaging 0.85
R5071:Plagl1 UTSW 10 13127261 missense probably damaging 1.00
R5138:Plagl1 UTSW 10 13128175 unclassified probably benign
R5893:Plagl1 UTSW 10 13128194 unclassified probably benign
R5971:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6061:Plagl1 UTSW 10 13127895 unclassified probably benign
R6138:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6170:Plagl1 UTSW 10 13127231 missense probably damaging 1.00
R6625:Plagl1 UTSW 10 13128062 unclassified probably benign
R6970:Plagl1 UTSW 10 13125116 missense probably damaging 1.00
R7035:Plagl1 UTSW 10 13128233 unclassified probably benign
U15987:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTGGAGCCTATGCAGCCAATG -3'
(R):5'- GCATCTACCAGCAGCTCTTTGGAC -3'

Sequencing Primer
(F):5'- tatgcagccaatgctgcc -3'
(R):5'- GACAGGGTGACTTTCCCAAAC -3'
Posted On2013-11-08