Incidental Mutation 'R0967:Atxn7l3'
ID83917
Institutional Source Beutler Lab
Gene Symbol Atxn7l3
Ensembl Gene ENSMUSG00000059995
Gene Nameataxin 7-like 3
Synonyms
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0967 (G1)
Quality Score192
Status Validated
Chromosome11
Chromosomal Location102289300-102296631 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to G at 102292435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036376] [ENSMUST00000073234] [ENSMUST00000107132] [ENSMUST00000107134] [ENSMUST00000137387] [ENSMUST00000156326]
Predicted Effect probably benign
Transcript: ENSMUST00000036376
SMART Domains Protein: ENSMUSP00000047600
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073234
SMART Domains Protein: ENSMUSP00000072967
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100387
SMART Domains Protein: ENSMUSP00000097956
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
UBQ 212 281 1.75e-9 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107132
SMART Domains Protein: ENSMUSP00000102750
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.1e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 209 246 7.8e-11 PFAM
low complexity region 282 295 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107134
SMART Domains Protein: ENSMUSP00000102752
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135551
Predicted Effect probably benign
Transcript: ENSMUST00000137387
SMART Domains Protein: ENSMUSP00000122610
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 76 108 2.6e-21 PFAM
low complexity region 131 139 N/A INTRINSIC
low complexity region 146 155 N/A INTRINSIC
Pfam:SCA7 205 242 1.9e-9 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141516
SMART Domains Protein: ENSMUSP00000121917
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 27 35 N/A INTRINSIC
low complexity region 42 51 N/A INTRINSIC
Pfam:SCA7 113 150 6.7e-11 PFAM
low complexity region 186 199 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145484
Predicted Effect probably benign
Transcript: ENSMUST00000156326
SMART Domains Protein: ENSMUSP00000116327
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mouse embryonic stem cells homozygous for a knock-out allele exhibit strikingly increased H2B monoubiquitination (H2Bub) levels and fail to show loss of global H2Bub following inhibition of transcriptional elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Atxn7l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn7l3 APN 11 102294981 missense probably benign 0.00
IGL01629:Atxn7l3 APN 11 102292494 unclassified probably benign
R0333:Atxn7l3 UTSW 11 102294992 unclassified probably null
R0970:Atxn7l3 UTSW 11 102292435 unclassified probably benign
R1073:Atxn7l3 UTSW 11 102292435 unclassified probably benign
R1388:Atxn7l3 UTSW 11 102292435 unclassified probably benign
R1518:Atxn7l3 UTSW 11 102294514 missense probably benign 0.04
R2119:Atxn7l3 UTSW 11 102291981 missense possibly damaging 0.63
R3708:Atxn7l3 UTSW 11 102291879 unclassified probably benign
R3856:Atxn7l3 UTSW 11 102293903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAAAGGTCACTTACGCCGAG -3'
(R):5'- ACTGGGATCAGCTATGAGACCCTG -3'

Sequencing Primer
(F):5'- TGATCAGACCCTGACAAGGC -3'
(R):5'- TAGCAGCAGGAGCCATAGTTTTC -3'
Posted On2013-11-08