Incidental Mutation 'R0967:Rubcn'
ID83923
Institutional Source Beutler Lab
Gene Symbol Rubcn
Ensembl Gene ENSMUSG00000035629
Gene NameRUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms1700021K19Rik
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32821703-32877766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32825717 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 815 (E815D)
Ref Sequence ENSEMBL: ENSMUSP00000155868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040986] [ENSMUST00000089684] [ENSMUST00000115105] [ENSMUST00000119810] [ENSMUST00000231478] [ENSMUST00000232269]
Predicted Effect probably benign
Transcript: ENSMUST00000040986
AA Change: E800D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048811
Gene: ENSMUSG00000035629
AA Change: E800D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 469 687 1e-66 BLAST
DUF4206 706 908 1.66e-113 SMART
low complexity region 915 941 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089684
AA Change: E815D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087114
Gene: ENSMUSG00000035629
AA Change: E815D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 484 702 1e-66 BLAST
DUF4206 721 923 1.66e-113 SMART
low complexity region 930 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115105
AA Change: E786D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629
AA Change: E786D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119810
AA Change: E739D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629
AA Change: E739D

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152920
Predicted Effect probably benign
Transcript: ENSMUST00000231478
AA Change: E815D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000232269
AA Change: E800D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Rubcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rubcn APN 16 32824377 critical splice donor site probably null
IGL00777:Rubcn APN 16 32836563 missense probably damaging 0.98
IGL01402:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL01404:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL02255:Rubcn APN 16 32827345 missense probably benign 0.04
IGL03019:Rubcn APN 16 32826707 missense probably damaging 0.98
IGL03388:Rubcn APN 16 32841568 missense probably benign 0.02
R0254:Rubcn UTSW 16 32847946 missense probably benign 0.00
R0373:Rubcn UTSW 16 32835980 missense probably damaging 1.00
R0636:Rubcn UTSW 16 32828686 missense probably damaging 1.00
R0839:Rubcn UTSW 16 32827343 missense probably damaging 0.98
R1711:Rubcn UTSW 16 32843101 missense probably damaging 1.00
R1819:Rubcn UTSW 16 32826914 missense possibly damaging 0.93
R1840:Rubcn UTSW 16 32826172 missense possibly damaging 0.83
R2511:Rubcn UTSW 16 32847254 missense probably damaging 1.00
R3932:Rubcn UTSW 16 32829259 splice site probably null
R3933:Rubcn UTSW 16 32829259 splice site probably null
R4384:Rubcn UTSW 16 32856902 missense probably damaging 0.96
R4788:Rubcn UTSW 16 32836408 critical splice donor site probably null
R4852:Rubcn UTSW 16 32843308 missense probably damaging 1.00
R4921:Rubcn UTSW 16 32847294 missense probably damaging 1.00
R4950:Rubcn UTSW 16 32843193 missense probably damaging 1.00
R5234:Rubcn UTSW 16 32836458 missense probably damaging 1.00
R5527:Rubcn UTSW 16 32826711 missense probably damaging 1.00
R5616:Rubcn UTSW 16 32826923 missense possibly damaging 0.76
R5823:Rubcn UTSW 16 32849721 missense probably damaging 0.98
R6970:Rubcn UTSW 16 32868144 intron probably benign
R7120:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7121:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7221:Rubcn UTSW 16 32866923 intron probably null
X0065:Rubcn UTSW 16 32847985 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAGCTAAATGACAGGAACCCTGCC -3'
(R):5'- CCCAACTGCCCGTTGTCTCTTAAAG -3'

Sequencing Primer
(F):5'- Gcccacctaagccccac -3'
(R):5'- GTCCAAGGTGAGACACCATTTTC -3'
Posted On2013-11-08