Incidental Mutation 'R0967:Hsd17b4'
ID83926
Institutional Source Beutler Lab
Gene Symbol Hsd17b4
Ensembl Gene ENSMUSG00000024507
Gene Namehydroxysteroid (17-beta) dehydrogenase 4
SynonymsD-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R0967 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location50128201-50196269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50183261 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 652 (H652N)
Ref Sequence ENSEMBL: ENSMUSP00000025385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025385]
Predicted Effect probably benign
Transcript: ENSMUST00000025385
AA Change: H652N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: H652N

DomainStartEndE-ValueType
Pfam:KR 10 186 2.1e-17 PFAM
Pfam:adh_short 10 208 2.3e-39 PFAM
Pfam:MaoC_dehydrat_N 346 451 1.4e-8 PFAM
low complexity region 458 470 N/A INTRINSIC
Pfam:MaoC_dehydratas 479 600 1.8e-41 PFAM
Pfam:SCP2 627 730 8.4e-27 PFAM
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Ms4a15 A T 19: 10,979,321 V209E probably damaging Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Hsd17b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Hsd17b4 APN 18 50164845 missense probably benign
IGL01369:Hsd17b4 APN 18 50172033 missense possibly damaging 0.95
IGL01411:Hsd17b4 APN 18 50191814 missense probably damaging 1.00
IGL01986:Hsd17b4 APN 18 50160126 splice site probably benign
IGL02126:Hsd17b4 APN 18 50181996 missense probably benign
IGL02496:Hsd17b4 APN 18 50155153 missense probably damaging 0.97
IGL02527:Hsd17b4 APN 18 50160164 missense probably benign 0.00
IGL02553:Hsd17b4 APN 18 50162097 splice site probably benign
IGL02813:Hsd17b4 APN 18 50128348 utr 5 prime probably benign
I0000:Hsd17b4 UTSW 18 50160228 missense probably benign 0.09
IGL02980:Hsd17b4 UTSW 18 50146518 missense probably benign 0.06
R0352:Hsd17b4 UTSW 18 50191784 missense probably benign
R0734:Hsd17b4 UTSW 18 50170777 missense possibly damaging 0.90
R1418:Hsd17b4 UTSW 18 50130187 splice site probably benign
R1661:Hsd17b4 UTSW 18 50160215 missense probably benign
R1665:Hsd17b4 UTSW 18 50160215 missense probably benign
R1752:Hsd17b4 UTSW 18 50170767 missense probably benign 0.27
R1804:Hsd17b4 UTSW 18 50177984 missense probably damaging 1.00
R2197:Hsd17b4 UTSW 18 50183302 splice site probably null
R4351:Hsd17b4 UTSW 18 50142634 missense probably damaging 1.00
R4405:Hsd17b4 UTSW 18 50128314 start gained probably benign
R4976:Hsd17b4 UTSW 18 50160135 missense probably damaging 1.00
R5788:Hsd17b4 UTSW 18 50173709 missense probably damaging 0.99
R5826:Hsd17b4 UTSW 18 50183172 missense probably benign 0.00
R5889:Hsd17b4 UTSW 18 50177209 missense probably damaging 1.00
R6475:Hsd17b4 UTSW 18 50172262 intron probably null
R6632:Hsd17b4 UTSW 18 50179102 missense possibly damaging 0.70
R7151:Hsd17b4 UTSW 18 50128370 missense probably damaging 1.00
R7367:Hsd17b4 UTSW 18 50155185 missense probably damaging 1.00
R7383:Hsd17b4 UTSW 18 50164850 missense probably benign 0.13
R7397:Hsd17b4 UTSW 18 50146424 missense probably damaging 1.00
R7509:Hsd17b4 UTSW 18 50164682 missense probably damaging 1.00
R7697:Hsd17b4 UTSW 18 50130141 missense probably damaging 1.00
R7722:Hsd17b4 UTSW 18 50146524 missense probably damaging 1.00
R7764:Hsd17b4 UTSW 18 50146415 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGGCTCTGGGCAGTATGATACAG -3'
(R):5'- TGCGCCAGCACATTACTTACATGG -3'

Sequencing Primer
(F):5'- CAGGTTAAAAATCACTTCTGGGGC -3'
(R):5'- ATGCTTTTGAATGTCCTGAGACC -3'
Posted On2013-11-08