Mutagenetix > Incidental Mutation

Incidental Mutation 'R0967:Adamts19'

83927

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

039096-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0967 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 58972740 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 736 (E736*)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably null
Transcript: ENSMUST00000052907
AA Change: E736*

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: E736*

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.1%
20x: 90.5%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn7l3	C	G	11: 102,292,435		probably benign	Het
Camk1g	T	C	1: 193,350,296	E269G	probably damaging	Het
Ccrl2	G	A	9: 111,055,686	T248M	probably benign	Het
Chd9	T	C	8: 90,989,479	S421P	probably damaging	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Csmd3	T	C	15: 47,857,831	E1468G	probably null	Het
Cyc1	T	C	15: 76,345,648		probably benign	Het
Fli1	T	A	9: 32,461,449	T98S	probably benign	Het
Gk2	T	C	5: 97,456,296	S228G	probably benign	Het
Gse1	T	A	8: 120,570,855		probably benign	Het
Hgf	T	A	5: 16,593,841		probably benign	Het
Hif1a	G	A	12: 73,937,670	V300I	possibly damaging	Het
Hsd17b4	C	A	18: 50,183,261	H652N	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Kif5c	T	A	2: 49,698,116		probably benign	Het
Lgr6	T	C	1: 134,994,012	Y198C	probably damaging	Het
Lpcat2b	T	A	5: 107,434,218	M471K	possibly damaging	Het
Med21	A	G	6: 146,650,199	E116G	probably benign	Het
Mos	A	G	4: 3,870,932	S295P	probably benign	Het
Ms4a15	A	T	19: 10,979,321	V209E	probably damaging	Het
Mttp	A	G	3: 138,092,723	V804A	probably benign	Het
Olfr205	T	A	16: 59,329,183	T109S	possibly damaging	Het
Olfr503	T	C	7: 108,544,789	I86T	probably damaging	Het
Olfr718-ps1	A	G	5: 143,137,839	M121T	probably damaging	Het
Plagl1	T	C	10: 13,128,242		probably benign	Het
Prpf8	T	A	11: 75,494,430	V797E	probably damaging	Het
Rars2	A	G	4: 34,646,587	D284G	probably benign	Het
Rassf8	T	C	6: 145,819,950		probably benign	Het
Rfx3	A	G	19: 27,806,351		probably benign	Het
Ripk4	A	T	16: 97,744,172	M362K	probably damaging	Het
Rsg1	T	C	4: 141,219,851	M181T	probably benign	Het
Rubcn	C	A	16: 32,825,717	E815D	probably benign	Het
Scn8a	A	G	15: 101,035,646	Y1577C	probably damaging	Het
Sec24b	C	T	3: 129,996,782	R698Q	probably damaging	Het
Ssc5d	T	A	7: 4,944,343	L1232*	probably null	Het
Usp7	A	T	16: 8,696,654		probably benign	Het
Vmn2r51	T	G	7: 10,100,085	H342P	probably damaging	Het
Vmn2r70	A	G	7: 85,559,619	M550T	probably damaging	Het
Vmn2r81	T	C	10: 79,248,023		probably benign	Het
Zc3h13	T	C	14: 75,343,739	I1722T	possibly damaging	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- AGTGAGTTGAGAGTGAGAATGCTACCA -3'
(R):5'- tgaggccATCTGAttcccccaaa -3'

Sequencing Primer
(F):5'- atgcacacatatataACATTTGAGGC -3'
(R):5'- tcccccaaatatcagtctaaagc -3'

Posted On

2013-11-08