Incidental Mutation 'R0967:Ms4a15'
ID83929
Institutional Source Beutler Lab
Gene Symbol Ms4a15
Ensembl Gene ENSMUSG00000067571
Gene Namemembrane-spanning 4-domains, subfamily A, member 15
SynonymsLOC383468, E530011F12Rik, Gm1286
MMRRC Submission 039096-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0967 (G1)
Quality Score112
Status Validated
Chromosome19
Chromosomal Location10978307-10993250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10979321 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 209 (V209E)
Ref Sequence ENSEMBL: ENSMUSP00000085234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072748] [ENSMUST00000087923] [ENSMUST00000144485] [ENSMUST00000145110] [ENSMUST00000191343]
Predicted Effect probably benign
Transcript: ENSMUST00000072748
SMART Domains Protein: ENSMUSP00000072531
Gene: ENSMUSG00000024731

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 56 190 6e-10 PFAM
low complexity region 239 252 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087923
AA Change: V209E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085234
Gene: ENSMUSG00000067571
AA Change: V209E

DomainStartEndE-ValueType
Pfam:CD20 76 170 1.8e-24 PFAM
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144485
Predicted Effect probably benign
Transcript: ENSMUST00000145110
SMART Domains Protein: ENSMUSP00000117513
Gene: ENSMUSG00000067571

DomainStartEndE-ValueType
Pfam:CD20 86 129 2.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191343
SMART Domains Protein: ENSMUSP00000140111
Gene: ENSMUSG00000024731

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:CD20 57 150 7.9e-14 PFAM
low complexity region 199 212 N/A INTRINSIC
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 G T 18: 58,972,740 E736* probably null Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Camk1g T C 1: 193,350,296 E269G probably damaging Het
Ccrl2 G A 9: 111,055,686 T248M probably benign Het
Chd9 T C 8: 90,989,479 S421P probably damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Csmd3 T C 15: 47,857,831 E1468G probably null Het
Cyc1 T C 15: 76,345,648 probably benign Het
Fli1 T A 9: 32,461,449 T98S probably benign Het
Gk2 T C 5: 97,456,296 S228G probably benign Het
Gse1 T A 8: 120,570,855 probably benign Het
Hgf T A 5: 16,593,841 probably benign Het
Hif1a G A 12: 73,937,670 V300I possibly damaging Het
Hsd17b4 C A 18: 50,183,261 H652N probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kif5c T A 2: 49,698,116 probably benign Het
Lgr6 T C 1: 134,994,012 Y198C probably damaging Het
Lpcat2b T A 5: 107,434,218 M471K possibly damaging Het
Med21 A G 6: 146,650,199 E116G probably benign Het
Mos A G 4: 3,870,932 S295P probably benign Het
Mttp A G 3: 138,092,723 V804A probably benign Het
Olfr205 T A 16: 59,329,183 T109S possibly damaging Het
Olfr503 T C 7: 108,544,789 I86T probably damaging Het
Olfr718-ps1 A G 5: 143,137,839 M121T probably damaging Het
Plagl1 T C 10: 13,128,242 probably benign Het
Prpf8 T A 11: 75,494,430 V797E probably damaging Het
Rars2 A G 4: 34,646,587 D284G probably benign Het
Rassf8 T C 6: 145,819,950 probably benign Het
Rfx3 A G 19: 27,806,351 probably benign Het
Ripk4 A T 16: 97,744,172 M362K probably damaging Het
Rsg1 T C 4: 141,219,851 M181T probably benign Het
Rubcn C A 16: 32,825,717 E815D probably benign Het
Scn8a A G 15: 101,035,646 Y1577C probably damaging Het
Sec24b C T 3: 129,996,782 R698Q probably damaging Het
Ssc5d T A 7: 4,944,343 L1232* probably null Het
Usp7 A T 16: 8,696,654 probably benign Het
Vmn2r51 T G 7: 10,100,085 H342P probably damaging Het
Vmn2r70 A G 7: 85,559,619 M550T probably damaging Het
Vmn2r81 T C 10: 79,248,023 probably benign Het
Zc3h13 T C 14: 75,343,739 I1722T possibly damaging Het
Other mutations in Ms4a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0137:Ms4a15 UTSW 19 10979333 unclassified probably benign
R0335:Ms4a15 UTSW 19 10980210 missense probably damaging 1.00
R0494:Ms4a15 UTSW 19 10981358 unclassified probably benign
R1906:Ms4a15 UTSW 19 10983280 missense probably benign 0.02
R2258:Ms4a15 UTSW 19 10984795 missense probably benign 0.02
R4835:Ms4a15 UTSW 19 10979226 missense possibly damaging 0.90
R6468:Ms4a15 UTSW 19 10993170 missense probably benign
R7047:Ms4a15 UTSW 19 10984872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAAACCGCTGCCTTAGAAC -3'
(R):5'- AAGGAGCCCAGTGAGTGACTACTAC -3'

Sequencing Primer
(F):5'- CTGCCTTAGAACGGACAAAGTG -3'
(R):5'- GCTGCTGTTCTCTGAATACCCA -3'
Posted On2013-11-08