Mutagenetix > Incidental Mutation

Incidental Mutation 'R0968:1110002E22Rik'

83939

Institutional Source

Beutler Lab

Gene Symbol

1110002E22Rik

Ensembl Gene

ENSMUSG00000090066

Gene Name

RIKEN cDNA 1110002E22 gene

Synonyms

MMRRC Submission

039097-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.587) question?

Stock #

R0968 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138065052-138081506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 138067206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 719 (V719M)

Ref Sequence

ENSEMBL: ENSMUSP00000123851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053318

Predicted Effect

probably damaging
Transcript: ENSMUST00000163080
AA Change: V719M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V719M

Domain	Start	End	E-Value	Type
low complexity region	44	55	N/A	INTRINSIC
low complexity region	87	102	N/A	INTRINSIC
low complexity region	229	247	N/A	INTRINSIC
low complexity region	422	438	N/A	INTRINSIC
low complexity region	459	505	N/A	INTRINSIC
low complexity region	667	680	N/A	INTRINSIC
low complexity region	937	948	N/A	INTRINSIC
low complexity region	995	1007	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
low complexity region	1224	1242	N/A	INTRINSIC
low complexity region	1376	1385	N/A	INTRINSIC
Pfam:DUF4585	1598	1667	6.9e-32	PFAM
low complexity region	1723	1738	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184925

Meta Mutation Damage Score

0.0916

Coding Region Coverage

1x: 99.5%
3x: 99.0%
10x: 98.0%
20x: 96.7%

Validation Efficiency

94% (34/36)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,298,016	S2588G	probably benign	Het
Acaca	C	T	11: 84,239,033	Q405*	probably null	Het
Brms1l	G	A	12: 55,866,013	D264N	possibly damaging	Het
Cabcoco1	T	C	10: 68,436,372	M254V	probably benign	Het
Cndp1	G	A	18: 84,634,652		probably benign	Het
Coro7	G	C	16: 4,670,055		probably benign	Het
Cylc2	A	G	4: 51,216,706	M1V	probably null	Het
Cyp3a11	G	A	5: 145,862,514		probably benign	Het
Dnah10	C	T	5: 124,829,577	T4224M	probably damaging	Het
Dnah2	T	C	11: 69,448,519	E3054G	possibly damaging	Het
Dnm3	A	G	1: 162,019,819		probably benign	Het
Efcab5	G	A	11: 77,140,923	R42W	probably damaging	Het
Fgf12	T	C	16: 28,162,433	N177S	probably null	Het
Flt3	C	T	5: 147,341,227	V846I	possibly damaging	Het
Gm11569	A	T	11: 99,798,424		probably benign	Het
Gm12695	A	C	4: 96,762,066	V181G	probably damaging	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Lars	C	A	18: 42,218,583	R852L	probably benign	Het
Lca5	T	C	9: 83,423,169	T195A	probably benign	Het
Lrrc40	G	A	3: 158,036,789	D14N	probably damaging	Het
Map4k2	T	C	19: 6,345,457	S327P	probably damaging	Het
Mpp4	A	G	1: 59,130,090	F397L	probably damaging	Het
Mtus2	T	C	5: 148,078,184	S596P	probably benign	Het
Myo3a	T	A	2: 22,558,289	N25K	probably damaging	Het
Nadsyn1	T	C	7: 143,806,033	T401A	probably benign	Het
Pde6a	A	T	18: 61,253,738	E395D	probably damaging	Het
Plekhm2	A	G	4: 141,629,932	V743A	probably benign	Het
Pzp	A	T	6: 128,525,145	D80E	probably benign	Het
Rp1	A	T	1: 4,345,352	C1846S	probably benign	Het
Shbg	A	G	11: 69,617,188	L117P	probably damaging	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slc5a2	G	C	7: 128,270,631	R412P	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Supt20	A	G	3: 54,708,400		probably benign	Het
Vcpip1	A	T	1: 9,746,379	I593N	probably damaging	Het

Other mutations in 1110002E22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0026:1110002E22Rik	UTSW	3	138066805	missense	possibly damaging	0.95
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0197:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0239:1110002E22Rik	UTSW	3	138065834	small deletion	probably benign
R0394:1110002E22Rik	UTSW	3	138067304	missense	probably damaging	0.99
R0401:1110002E22Rik	UTSW	3	138070306	missense	possibly damaging	0.73
R0496:1110002E22Rik	UTSW	3	138068244	missense	probably damaging	1.00
R0591:1110002E22Rik	UTSW	3	138068943	nonsense	probably null
R0711:1110002E22Rik	UTSW	3	138068225	missense	probably damaging	0.99
R0883:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0908:1110002E22Rik	UTSW	3	138070077	missense	probably damaging	0.99
R1023:1110002E22Rik	UTSW	3	138066871	missense	probably damaging	1.00
R1168:1110002E22Rik	UTSW	3	138067900	missense	probably benign	0.20
R1472:1110002E22Rik	UTSW	3	138067552	missense	possibly damaging	0.95
R1538:1110002E22Rik	UTSW	3	138065401	missense	probably benign	0.02
R1648:1110002E22Rik	UTSW	3	138069420	missense	probably benign	0.18
R1800:1110002E22Rik	UTSW	3	138066718	missense	probably damaging	1.00
R1919:1110002E22Rik	UTSW	3	138067270	missense	probably damaging	0.99
R1974:1110002E22Rik	UTSW	3	138067267	missense	probably damaging	1.00
R1990:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R1991:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R2102:1110002E22Rik	UTSW	3	138065173	missense	probably damaging	0.99
R2761:1110002E22Rik	UTSW	3	138067780	missense	probably damaging	0.99
R2899:1110002E22Rik	UTSW	3	138065682	missense	probably benign	0.00
R3618:1110002E22Rik	UTSW	3	138068407	missense	probably damaging	1.00
R3904:1110002E22Rik	UTSW	3	138066639	missense	probably benign	0.15
R3955:1110002E22Rik	UTSW	3	138068073	missense	probably benign	0.00
R4520:1110002E22Rik	UTSW	3	138070266	missense	probably damaging	0.99
R4619:1110002E22Rik	UTSW	3	138069759	missense	probably damaging	0.99
R4736:1110002E22Rik	UTSW	3	138068485	missense	probably damaging	0.99
R4752:1110002E22Rik	UTSW	3	138069990	missense	possibly damaging	0.91
R4777:1110002E22Rik	UTSW	3	138065742	missense	probably benign	0.09
R4780:1110002E22Rik	UTSW	3	138065370	missense	probably benign	0.02
R4824:1110002E22Rik	UTSW	3	138065676	missense	probably benign	0.00
R4829:1110002E22Rik	UTSW	3	138069019	missense	probably damaging	0.99
R4965:1110002E22Rik	UTSW	3	138069672	missense	probably benign
R5206:1110002E22Rik	UTSW	3	138066511	missense	probably benign	0.00
R5212:1110002E22Rik	UTSW	3	138065850	missense	possibly damaging	0.85
R5373:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5374:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5506:1110002E22Rik	UTSW	3	138067947	missense	probably damaging	1.00
R5528:1110002E22Rik	UTSW	3	138066499	missense	probably benign
R5536:1110002E22Rik	UTSW	3	138066388	missense	possibly damaging	0.89
R5587:1110002E22Rik	UTSW	3	138065409	missense	probably benign
R5759:1110002E22Rik	UTSW	3	138068658	missense	probably benign
R5933:1110002E22Rik	UTSW	3	138070348	missense	probably damaging	1.00
R5957:1110002E22Rik	UTSW	3	138070161	missense	probably benign
R6092:1110002E22Rik	UTSW	3	138068940	missense	probably benign	0.02
R6305:1110002E22Rik	UTSW	3	138067980	missense	probably damaging	1.00
R6457:1110002E22Rik	UTSW	3	138066622	missense	probably damaging	1.00
R6469:1110002E22Rik	UTSW	3	138066975	missense	probably damaging	0.97
R6499:1110002E22Rik	UTSW	3	138068800	missense	probably damaging	1.00
R6527:1110002E22Rik	UTSW	3	138067527	missense	probably damaging	0.99
R6580:1110002E22Rik	UTSW	3	138066625	missense	probably benign	0.00
R6693:1110002E22Rik	UTSW	3	138069154	missense	probably benign	0.00
R6751:1110002E22Rik	UTSW	3	138066210	missense	probably damaging	1.00
R6852:1110002E22Rik	UTSW	3	138065169	nonsense	probably null
R6920:1110002E22Rik	UTSW	3	138068050	missense	probably damaging	1.00
R7001:1110002E22Rik	UTSW	3	138065511	missense	probably benign
R7145:1110002E22Rik	UTSW	3	138070059	missense	probably damaging	1.00
R7238:1110002E22Rik	UTSW	3	138069951	missense	probably damaging	1.00
R7278:1110002E22Rik	UTSW	3	138065476	missense	probably benign
R7425:1110002E22Rik	UTSW	3	138065695	missense	probably benign	0.00
R7487:1110002E22Rik	UTSW	3	138066868	missense	probably damaging	1.00
R7557:1110002E22Rik	UTSW	3	138068283	nonsense	probably null
R7663:1110002E22Rik	UTSW	3	138066126	missense	probably damaging	0.98
R7743:1110002E22Rik	UTSW	3	138068755	missense	probably damaging	1.00
R7799:1110002E22Rik	UTSW	3	138069601	missense	probably benign	0.33
R8181:1110002E22Rik	UTSW	3	138068395	missense	probably damaging	0.99
R8264:1110002E22Rik	UTSW	3	138067782	missense	probably damaging	0.99
R8273:1110002E22Rik	UTSW	3	138066450	missense	probably benign
R8434:1110002E22Rik	UTSW	3	138067260	missense	probably damaging	0.97
R8530:1110002E22Rik	UTSW	3	138068825	missense	probably damaging	0.99
R8754:1110002E22Rik	UTSW	3	138066037	missense	probably benign
R8808:1110002E22Rik	UTSW	3	138070113	missense	probably benign	0.01
R8891:1110002E22Rik	UTSW	3	138066759	nonsense	probably null
R9026:1110002E22Rik	UTSW	3	138065148	missense	possibly damaging	0.53
R9177:1110002E22Rik	UTSW	3	138069916	missense	probably damaging	1.00
R9250:1110002E22Rik	UTSW	3	138066628	missense	probably damaging	1.00
R9291:1110002E22Rik	UTSW	3	138066703	missense	probably benign	0.02
R9293:1110002E22Rik	UTSW	3	138066078	missense	possibly damaging	0.93
R9307:1110002E22Rik	UTSW	3	138065422	missense	probably benign	0.04
R9439:1110002E22Rik	UTSW	3	138066287	missense	probably benign	0.00
R9509:1110002E22Rik	UTSW	3	138065834	small deletion	probably benign
R9582:1110002E22Rik	UTSW	3	138067005	missense	probably damaging	0.99
R9599:1110002E22Rik	UTSW	3	138068506	missense	probably benign	0.16
X0003:1110002E22Rik	UTSW	3	138069096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGGACGATGGTCAACCTTCCTG -3'
(R):5'- GATGTCTCTGAGCCGTCATCTGTG -3'

Sequencing Primer
(F):5'- CCTTCCTGGACTTAAAATGTGG -3'
(R):5'- TGTACACAGAGCCTGGACC -3'

Posted On

2013-11-08