Incidental Mutation 'R0968:Gm12695'
ID83942
Institutional Source Beutler Lab
Gene Symbol Gm12695
Ensembl Gene ENSMUSG00000078639
Gene Namepredicted gene 12695
Synonyms
MMRRC Submission 039097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0968 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96723647-96785186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 96762066 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 181 (V181G)
Ref Sequence ENSEMBL: ENSMUSP00000102686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107071]
Predicted Effect probably damaging
Transcript: ENSMUST00000107071
AA Change: V181G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102686
Gene: ENSMUSG00000078639
AA Change: V181G

DomainStartEndE-ValueType
low complexity region 226 237 N/A INTRINSIC
low complexity region 360 371 N/A INTRINSIC
Meta Mutation Damage Score 0.3082 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,067,206 V719M probably damaging Het
Abca13 A G 11: 9,298,016 S2588G probably benign Het
Acaca C T 11: 84,239,033 Q405* probably null Het
Brms1l G A 12: 55,866,013 D264N possibly damaging Het
Cabcoco1 T C 10: 68,436,372 M254V probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Coro7 G C 16: 4,670,055 probably benign Het
Cylc2 A G 4: 51,216,706 M1V probably null Het
Cyp3a11 G A 5: 145,862,514 probably benign Het
Dnah10 C T 5: 124,829,577 T4224M probably damaging Het
Dnah2 T C 11: 69,448,519 E3054G possibly damaging Het
Dnm3 A G 1: 162,019,819 probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Fgf12 T C 16: 28,162,433 N177S probably null Het
Flt3 C T 5: 147,341,227 V846I possibly damaging Het
Gm11569 A T 11: 99,798,424 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lars C A 18: 42,218,583 R852L probably benign Het
Lca5 T C 9: 83,423,169 T195A probably benign Het
Lrrc40 G A 3: 158,036,789 D14N probably damaging Het
Map4k2 T C 19: 6,345,457 S327P probably damaging Het
Mpp4 A G 1: 59,130,090 F397L probably damaging Het
Mtus2 T C 5: 148,078,184 S596P probably benign Het
Myo3a T A 2: 22,558,289 N25K probably damaging Het
Nadsyn1 T C 7: 143,806,033 T401A probably benign Het
Pde6a A T 18: 61,253,738 E395D probably damaging Het
Plekhm2 A G 4: 141,629,932 V743A probably benign Het
Pzp A T 6: 128,525,145 D80E probably benign Het
Rp1 A T 1: 4,345,352 C1846S probably benign Het
Shbg A G 11: 69,617,188 L117P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Supt20 A G 3: 54,708,400 probably benign Het
Vcpip1 A T 1: 9,746,379 I593N probably damaging Het
Other mutations in Gm12695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Gm12695 APN 4 96749182 missense probably damaging 1.00
IGL01016:Gm12695 APN 4 96757947 missense probably benign 0.03
IGL02605:Gm12695 APN 4 96762751 missense probably null 0.92
IGL02734:Gm12695 APN 4 96724030 nonsense probably null
IGL02869:Gm12695 APN 4 96762133 splice site probably benign
IGL02895:Gm12695 APN 4 96723949 missense probably damaging 0.99
R0020:Gm12695 UTSW 4 96769735 missense probably damaging 0.96
R0465:Gm12695 UTSW 4 96785075 missense probably damaging 1.00
R0941:Gm12695 UTSW 4 96728217 nonsense probably null
R1965:Gm12695 UTSW 4 96762845 missense probably benign 0.16
R1983:Gm12695 UTSW 4 96738977 missense possibly damaging 0.84
R2051:Gm12695 UTSW 4 96769771 missense probably damaging 0.99
R2063:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2064:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2065:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2066:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2067:Gm12695 UTSW 4 96769726 missense probably benign 0.14
R2073:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2075:Gm12695 UTSW 4 96723945 missense possibly damaging 0.76
R2233:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2234:Gm12695 UTSW 4 96724029 missense probably damaging 1.00
R2327:Gm12695 UTSW 4 96769656 missense probably benign 0.00
R2507:Gm12695 UTSW 4 96754189 missense probably damaging 0.99
R3836:Gm12695 UTSW 4 96762097 missense probably damaging 0.99
R4685:Gm12695 UTSW 4 96761980 missense probably damaging 1.00
R5491:Gm12695 UTSW 4 96769668 missense possibly damaging 0.84
R5792:Gm12695 UTSW 4 96728283 missense probably benign 0.00
R6767:Gm12695 UTSW 4 96762696 intron probably null
R6786:Gm12695 UTSW 4 96762821 missense probably damaging 1.00
R6874:Gm12695 UTSW 4 96785069 missense probably benign 0.04
R6923:Gm12695 UTSW 4 96769816 missense probably benign 0.00
R6978:Gm12695 UTSW 4 96769722 missense possibly damaging 0.69
R7810:Gm12695 UTSW 4 96731371 missense probably damaging 0.99
Z1177:Gm12695 UTSW 4 96749223 missense not run
Predicted Primers PCR Primer
(F):5'- GTGGCAGAGGGACTTTATGCCTTAG -3'
(R):5'- TGTGCATGGTAAGCACTAGTCACTG -3'

Sequencing Primer
(F):5'- CTTTATGCCTTAGGAAGAGGCAG -3'
(R):5'- GAATGAATACTTTTCCTCAGGTGGC -3'
Posted On2013-11-08