Incidental Mutation 'R0968:Cabcoco1'
ID83954
Institutional Source Beutler Lab
Gene Symbol Cabcoco1
Ensembl Gene ENSMUSG00000019945
Gene Nameciliary associated calcium binding coiled-coil 1
Synonyms1700040L02Rik
MMRRC Submission 039097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0968 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location68430953-68541896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68436372 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 254 (M254V)
Ref Sequence ENSEMBL: ENSMUSP00000020103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020103] [ENSMUST00000166919]
Predicted Effect probably benign
Transcript: ENSMUST00000020103
AA Change: M254V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020103
Gene: ENSMUSG00000019945
AA Change: M254V

DomainStartEndE-ValueType
Pfam:CLAMP 93 192 1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166919
AA Change: M154V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128895
Gene: ENSMUSG00000019945
AA Change: M154V

DomainStartEndE-ValueType
Pfam:CLAMP 1 94 1.2e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,067,206 V719M probably damaging Het
Abca13 A G 11: 9,298,016 S2588G probably benign Het
Acaca C T 11: 84,239,033 Q405* probably null Het
Brms1l G A 12: 55,866,013 D264N possibly damaging Het
Cndp1 G A 18: 84,634,652 probably benign Het
Coro7 G C 16: 4,670,055 probably benign Het
Cylc2 A G 4: 51,216,706 M1V probably null Het
Cyp3a11 G A 5: 145,862,514 probably benign Het
Dnah10 C T 5: 124,829,577 T4224M probably damaging Het
Dnah2 T C 11: 69,448,519 E3054G possibly damaging Het
Dnm3 A G 1: 162,019,819 probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Fgf12 T C 16: 28,162,433 N177S probably null Het
Flt3 C T 5: 147,341,227 V846I possibly damaging Het
Gm11569 A T 11: 99,798,424 probably benign Het
Gm12695 A C 4: 96,762,066 V181G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Lars C A 18: 42,218,583 R852L probably benign Het
Lca5 T C 9: 83,423,169 T195A probably benign Het
Lrrc40 G A 3: 158,036,789 D14N probably damaging Het
Map4k2 T C 19: 6,345,457 S327P probably damaging Het
Mpp4 A G 1: 59,130,090 F397L probably damaging Het
Mtus2 T C 5: 148,078,184 S596P probably benign Het
Myo3a T A 2: 22,558,289 N25K probably damaging Het
Nadsyn1 T C 7: 143,806,033 T401A probably benign Het
Pde6a A T 18: 61,253,738 E395D probably damaging Het
Plekhm2 A G 4: 141,629,932 V743A probably benign Het
Pzp A T 6: 128,525,145 D80E probably benign Het
Rp1 A T 1: 4,345,352 C1846S probably benign Het
Shbg A G 11: 69,617,188 L117P probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Supt20 A G 3: 54,708,400 probably benign Het
Vcpip1 A T 1: 9,746,379 I593N probably damaging Het
Other mutations in Cabcoco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Cabcoco1 APN 10 68541805 missense possibly damaging 0.94
IGL00644:Cabcoco1 APN 10 68533900 missense probably benign 0.18
IGL02253:Cabcoco1 APN 10 68436277 splice site probably null
R0060:Cabcoco1 UTSW 10 68533862 synonymous probably null
R0629:Cabcoco1 UTSW 10 68516278 missense probably damaging 1.00
R2108:Cabcoco1 UTSW 10 68431323 missense probably benign 0.04
R2154:Cabcoco1 UTSW 10 68431262 missense probably damaging 1.00
R3076:Cabcoco1 UTSW 10 68525645 missense possibly damaging 0.62
R3077:Cabcoco1 UTSW 10 68525645 missense possibly damaging 0.62
R3872:Cabcoco1 UTSW 10 68516278 missense probably damaging 1.00
R4876:Cabcoco1 UTSW 10 68541769 missense probably benign
R6299:Cabcoco1 UTSW 10 68436890 missense probably damaging 0.99
R6460:Cabcoco1 UTSW 10 68516381 missense probably damaging 1.00
R7127:Cabcoco1 UTSW 10 68436330 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACCAGAGCGGAGCAGTGTTTACAG -3'
(R):5'- GCTGACGTTTTCCCAGACAACATTC -3'

Sequencing Primer
(F):5'- ACAGATGTTGCCTAATTTGCC -3'
(R):5'- CACTTGTAATCCCTAAGGTACATGG -3'
Posted On2013-11-08