Incidental Mutation 'R0969:St8sia6'
ID83974
Institutional Source Beutler Lab
Gene Symbol St8sia6
Ensembl Gene ENSMUSG00000003418
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
SynonymsSiat8f, ST8Sia VI, 1700007J08Rik
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location13651021-13794064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13696869 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 112 (R112S)
Ref Sequence ENSEMBL: ENSMUSP00000003509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003509]
Predicted Effect probably benign
Transcript: ENSMUST00000003509
AA Change: R112S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003509
Gene: ENSMUSG00000003418
AA Change: R112S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_29 138 393 4.2e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150781
Meta Mutation Damage Score 0.1048 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 29 protein family. Members of this protein family synthesize sialylglycoconjugates. Sialylation may contribute to multidrug resistance in cancer cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in St8sia6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:St8sia6 APN 2 13665507 missense probably damaging 1.00
IGL02153:St8sia6 APN 2 13656905 missense probably damaging 1.00
IGL02302:St8sia6 APN 2 13723513 missense probably benign 0.01
IGL02338:St8sia6 APN 2 13793345 missense probably damaging 0.97
R0395:St8sia6 UTSW 2 13665436 missense probably damaging 1.00
R0621:St8sia6 UTSW 2 13657282 missense probably damaging 0.99
R0736:St8sia6 UTSW 2 13668885 missense probably benign 0.12
R1258:St8sia6 UTSW 2 13656884 missense probably benign 0.00
R1587:St8sia6 UTSW 2 13672605 missense possibly damaging 0.85
R1931:St8sia6 UTSW 2 13792812 missense probably benign 0.00
R3717:St8sia6 UTSW 2 13656934 missense possibly damaging 0.79
R3892:St8sia6 UTSW 2 13672524 missense probably benign 0.00
R4518:St8sia6 UTSW 2 13792751 splice site probably null
R4763:St8sia6 UTSW 2 13672530 missense probably damaging 0.97
R4933:St8sia6 UTSW 2 13665442 missense probably damaging 1.00
R5323:St8sia6 UTSW 2 13793377 missense possibly damaging 0.64
R7199:St8sia6 UTSW 2 13656910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGTGAGCCCCTTCCACTT -3'
(R):5'- TGCAGCTTTCTCATTATAGCGCAATCT -3'

Sequencing Primer
(F):5'- ACTTTCTTTTTAACAACTTGCTGC -3'
(R):5'- atgtgtgtgtCCTTACTACATATTCC -3'
Posted On2013-11-08