Incidental Mutation 'R0969:Ugt2b38'
ID83979
Institutional Source Beutler Lab
Gene Symbol Ugt2b38
Ensembl Gene ENSMUSG00000061906
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B38
Synonyms
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87409942-87424203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87412373 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 361 (N361H)
Ref Sequence ENSEMBL: ENSMUSP00000072598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072818]
Predicted Effect probably damaging
Transcript: ENSMUST00000072818
AA Change: N361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072598
Gene: ENSMUSG00000061906
AA Change: N361H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 4.1e-255 PFAM
Pfam:Glyco_tran_28_C 330 444 1.2e-7 PFAM
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Ugt2b38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ugt2b38 APN 5 87411823 missense probably damaging 1.00
IGL02326:Ugt2b38 APN 5 87423733 missense probably damaging 1.00
IGL02537:Ugt2b38 APN 5 87421731 missense possibly damaging 0.91
IGL02543:Ugt2b38 APN 5 87423483 missense probably benign 0.00
IGL02852:Ugt2b38 APN 5 87411741 missense probably benign
IGL03008:Ugt2b38 APN 5 87412423 missense probably benign 0.00
over_easy UTSW 5 87423742 missense probably benign 0.25
R0089:Ugt2b38 UTSW 5 87420558 missense probably benign 0.00
R0647:Ugt2b38 UTSW 5 87423469 missense probably benign 0.00
R0731:Ugt2b38 UTSW 5 87420452 missense probably damaging 1.00
R0837:Ugt2b38 UTSW 5 87411773 missense probably damaging 1.00
R0966:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0970:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0971:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1068:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1070:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1071:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1073:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1133:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1134:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1367:Ugt2b38 UTSW 5 87424114 missense probably benign 0.11
R1383:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1565:Ugt2b38 UTSW 5 87411914 missense probably damaging 0.99
R1691:Ugt2b38 UTSW 5 87424132 missense probably benign
R1725:Ugt2b38 UTSW 5 87411871 missense probably damaging 1.00
R1736:Ugt2b38 UTSW 5 87423633 missense probably benign
R2230:Ugt2b38 UTSW 5 87421668 missense probably benign 0.05
R2419:Ugt2b38 UTSW 5 87423732 missense probably damaging 1.00
R2496:Ugt2b38 UTSW 5 87421692 missense probably damaging 1.00
R3196:Ugt2b38 UTSW 5 87410219 missense probably damaging 0.96
R3773:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R5125:Ugt2b38 UTSW 5 87411812 missense probably damaging 1.00
R5224:Ugt2b38 UTSW 5 87423742 missense probably benign 0.25
R5516:Ugt2b38 UTSW 5 87411843 missense probably damaging 1.00
R5765:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R6352:Ugt2b38 UTSW 5 87424001 missense possibly damaging 0.73
R7166:Ugt2b38 UTSW 5 87410446 missense probably damaging 1.00
R7210:Ugt2b38 UTSW 5 87410425 missense probably damaging 0.99
R7291:Ugt2b38 UTSW 5 87411895 missense probably damaging 1.00
R7483:Ugt2b38 UTSW 5 87424114 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGGCCCCACCATGAGTTACAAAG -3'
(R):5'- GGCACACTCGTTGCTCAGTCTT -3'

Sequencing Primer
(F):5'- CTCTGTCTCAGAGCTAGAAGAATC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2013-11-08