Incidental Mutation 'R0969:Suclg1'
ID83982
Institutional Source Beutler Lab
Gene Symbol Suclg1
Ensembl Gene ENSMUSG00000052738
Gene Namesuccinate-CoA ligase, GDP-forming, alpha subunit
SynonymsSucla1, 1500000I01Rik
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location73248382-73276911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73271116 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 273 (H273Q)
Ref Sequence ENSEMBL: ENSMUSP00000065113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064740] [ENSMUST00000203632]
Predicted Effect probably benign
Transcript: ENSMUST00000064740
AA Change: H273Q

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065113
Gene: ENSMUSG00000052738
AA Change: H273Q

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
CoA_binding 51 147 6.28e-35 SMART
Pfam:Succ_CoA_lig 193 336 6.7e-11 PFAM
Pfam:Ligase_CoA 199 324 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203632
SMART Domains Protein: ENSMUSP00000145246
Gene: ENSMUSG00000052738

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
PDB:1EUD|A 37 67 2e-12 PDB
SCOP:d1euca1 41 68 6e-13 SMART
Meta Mutation Damage Score 0.1198 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Suclg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Suclg1 APN 6 73264297 intron probably benign
IGL02657:Suclg1 APN 6 73260521 missense probably damaging 1.00
IGL03250:Suclg1 APN 6 73270992 missense probably benign 0.04
IGL03306:Suclg1 APN 6 73270992 missense probably benign 0.04
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0379:Suclg1 UTSW 6 73256228 missense possibly damaging 0.89
R1123:Suclg1 UTSW 6 73256227 missense probably benign 0.02
R2089:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R5083:Suclg1 UTSW 6 73263980 missense probably benign
R6176:Suclg1 UTSW 6 73275343 missense probably damaging 1.00
R6313:Suclg1 UTSW 6 73256209 missense probably damaging 0.97
R6338:Suclg1 UTSW 6 73264246 missense probably damaging 1.00
R7231:Suclg1 UTSW 6 73263971 missense probably benign 0.00
R7246:Suclg1 UTSW 6 73276713 missense unknown
R7250:Suclg1 UTSW 6 73271091 missense probably benign 0.00
R7524:Suclg1 UTSW 6 73263841 missense probably damaging 0.99
R7829:Suclg1 UTSW 6 73275243 intron probably null
Predicted Primers PCR Primer
(F):5'- ATCCTTTGACCTTCTCAGGCATTGG -3'
(R):5'- AACTCTCTCCTCTCAGCAAGAGTCC -3'

Sequencing Primer
(F):5'- CTCAGGCATTGGAGGTGAC -3'
(R):5'- TCAACTACACAATGATGGGTGAC -3'
Posted On2013-11-08