Incidental Mutation 'R0969:Afg1l'
ID83987
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene NameAFG1 like ATPase
SynonymsLace1
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0969 (G1)
Quality Score200
Status Validated
Chromosome10
Chromosomal Location42312585-42478565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42318621 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 392 (T392A)
Ref Sequence ENSEMBL: ENSMUSP00000036149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
Predicted Effect probably damaging
Transcript: ENSMUST00000041024
AA Change: T392A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302
AA Change: T392A

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133326
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149832
SMART Domains Protein: ENSMUSP00000119620
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 2 80 5.3e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000151747
AA Change: T259A
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302
AA Change: T259A

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Meta Mutation Damage Score 0.4815 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42339911 missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42454380 missense probably damaging 0.98
IGL02309:Afg1l APN 10 42454378 missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42454510 nonsense probably null
IGL03088:Afg1l APN 10 42426497 missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42454370 nonsense probably null
R1665:Afg1l UTSW 10 42426577 missense probably damaging 1.00
R1703:Afg1l UTSW 10 42400399 missense probably damaging 1.00
R1766:Afg1l UTSW 10 42454495 missense probably benign 0.00
R2941:Afg1l UTSW 10 42478295 splice site probably null
R4846:Afg1l UTSW 10 42454494 missense probably benign 0.02
R4887:Afg1l UTSW 10 42454378 missense probably benign 0.00
R5668:Afg1l UTSW 10 42360240 missense probably damaging 1.00
R5934:Afg1l UTSW 10 42318686 missense probably damaging 1.00
R6575:Afg1l UTSW 10 42318716 missense probably damaging 1.00
R6972:Afg1l UTSW 10 42478374 missense probably benign 0.00
R7270:Afg1l UTSW 10 42425249 missense probably damaging 1.00
R7271:Afg1l UTSW 10 42415548 critical splice donor site probably null
R7577:Afg1l UTSW 10 42318611 missense probably damaging 1.00
R8458:Afg1l UTSW 10 42426521 missense probably damaging 0.98
Z1176:Afg1l UTSW 10 42478353 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCTTGTAACGGAGCTTGACAC -3'
(R):5'- AAACTGCCTCATCGGGTCTAGTCAC -3'

Sequencing Primer
(F):5'- TGTAACGGAGCTTGACACTACTG -3'
(R):5'- GGGTCTAGTCACCCTAAAGTTAC -3'
Posted On2013-11-08