Incidental Mutation 'R0969:Obscn'
Institutional Source Beutler Lab
Gene Symbol Obscn
Ensembl Gene ENSMUSG00000061462
Gene Nameobscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
SynonymsOTTMUSG00000005786, LOC380698
MMRRC Submission 039098-MU
Accession Numbers

Genbank: NM_001171512.1, NM_199152.2; MGI: 2681862

Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosomal Location58994256-59136402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59131646 bp
Amino Acid Change Arginine to Glycine at position 758 (R758G)
Ref Sequence ENSEMBL: ENSMUSP00000020732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020732] [ENSMUST00000047441] [ENSMUST00000052872] [ENSMUST00000219084]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020732
AA Change: R758G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020732
Gene: ENSMUSG00000061462
AA Change: R758G

IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 4.49e-6 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 2.54e-5 SMART
IGc2 1152 1218 4.49e-6 SMART
IGc2 1244 1310 7.82e-6 SMART
IGc2 1336 1402 5.16e-6 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 1.93e-5 SMART
IGc2 1888 1954 1.93e-5 SMART
IGc2 1980 2046 7.94e-7 SMART
IGc2 2072 2138 6.35e-6 SMART
IG 2158 2238 5.37e-4 SMART
IG 2248 2327 9.93e-8 SMART
IG 2338 2417 2.48e-8 SMART
IG 2427 2506 3.89e-1 SMART
IG 2516 2595 1.92e0 SMART
IG 2605 2683 6.45e-7 SMART
IG 2728 2807 1.22e-7 SMART
IGc2 2913 2979 9.93e-8 SMART
low complexity region 2981 2992 N/A INTRINSIC
IG 2996 3075 2.44e0 SMART
IGc2 3091 3157 2.1e-6 SMART
IG 3174 3255 2.86e0 SMART
IGc2 3271 3337 8.38e-6 SMART
IG 3354 3433 1.2e-6 SMART
IG 3443 3524 1.42e-3 SMART
IGc2 3540 3606 3.85e-5 SMART
IGc2 3629 3695 3.13e-5 SMART
IGc2 3718 3783 3.3e-4 SMART
IGc2 3806 3871 5.84e-5 SMART
IGc2 3894 3959 1.29e-6 SMART
IG_like 3982 4047 5.5e-1 SMART
IGc2 4054 4119 1.46e-5 SMART
IGc2 4142 4207 1.25e-4 SMART
IGc2 4230 4295 1.56e-5 SMART
IGc2 4318 4383 1.19e-5 SMART
IG_like 4400 4479 2.1e1 SMART
IGc2 4495 4560 1.93e-5 SMART
IGc2 4583 4648 3.91e-6 SMART
IG 4665 4743 1.85e-7 SMART
IG 4753 4831 1.03e-5 SMART
IGc2 4847 4912 5.08e-5 SMART
IGc2 4935 5001 5.08e-5 SMART
IGc2 5024 5090 1.11e-5 SMART
IGc2 5113 5181 6.71e-5 SMART
IG 5198 5280 2.06e-5 SMART
low complexity region 5307 5321 N/A INTRINSIC
IG 5377 5459 1.04e-1 SMART
IG 5469 5551 9.12e-7 SMART
FN3 5554 5636 2.44e-14 SMART
IG 5658 5740 3.68e-2 SMART
IQ 5900 5922 3.65e-4 SMART
IGc2 5939 6007 8.72e-4 SMART
low complexity region 6015 6031 N/A INTRINSIC
low complexity region 6032 6048 N/A INTRINSIC
low complexity region 6051 6074 N/A INTRINSIC
IGc2 6169 6237 3.25e-12 SMART
low complexity region 6250 6266 N/A INTRINSIC
IG 6296 6380 1.55e0 SMART
IGc2 6412 6485 1.82e-6 SMART
low complexity region 6599 6629 N/A INTRINSIC
SH3 6632 6695 1.22e0 SMART
Pfam:RhoGEF 6726 6904 2.8e-22 PFAM
PH 6925 7035 2.74e-11 SMART
IGc2 7055 7123 3.73e-12 SMART
IGc2 7149 7218 1.18e-14 SMART
low complexity region 7259 7273 N/A INTRINSIC
low complexity region 7274 7301 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047441
AA Change: R758G

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462
AA Change: R758G

IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 2.54e-5 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 4.49e-6 SMART
IGc2 1152 1218 7.82e-6 SMART
IGc2 1244 1310 5.16e-6 SMART
IGc2 1336 1402 1.93e-5 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 7.94e-7 SMART
IG 1882 1962 5.37e-4 SMART
IG 1972 2051 9.93e-8 SMART
IG 2062 2141 2.48e-8 SMART
IG 2151 2230 3.89e-1 SMART
IG 2240 2319 1.92e0 SMART
IG 2329 2407 6.45e-7 SMART
IG 2452 2531 1.22e-7 SMART
IGc2 2637 2703 9.93e-8 SMART
low complexity region 2705 2716 N/A INTRINSIC
IG 2720 2799 2.44e0 SMART
IGc2 2815 2881 2.1e-6 SMART
IG 2898 2979 2.86e0 SMART
IGc2 2995 3061 8.38e-6 SMART
IG 3078 3157 1.2e-6 SMART
IG 3167 3248 1.42e-3 SMART
IGc2 3264 3330 3.85e-5 SMART
IGc2 3353 3419 3.13e-5 SMART
IGc2 3442 3507 3.3e-4 SMART
IGc2 3530 3595 5.84e-5 SMART
IGc2 3618 3683 1.29e-6 SMART
IG_like 3706 3771 3.16e-1 SMART
IGc2 3779 3844 1.46e-5 SMART
IGc2 3867 3932 1.56e-5 SMART
IGc2 3955 4020 1.19e-5 SMART
IGc2 4043 4108 1.93e-5 SMART
IG 4125 4203 1.85e-7 SMART
IGc2 4219 4285 5.08e-5 SMART
IGc2 4308 4374 1.11e-5 SMART
IGc2 4397 4465 6.71e-5 SMART
IG 4482 4564 2.06e-5 SMART
IG 4574 4655 5.01e-4 SMART
IG 4664 4746 1.04e-1 SMART
FN3 4749 4831 2.44e-14 SMART
IG 4858 4940 3.68e-2 SMART
IQ 5100 5122 3.65e-4 SMART
IGc2 5139 5207 8.72e-4 SMART
low complexity region 5215 5231 N/A INTRINSIC
low complexity region 5232 5248 N/A INTRINSIC
low complexity region 5251 5274 N/A INTRINSIC
IGc2 5369 5437 3.25e-12 SMART
low complexity region 5450 5466 N/A INTRINSIC
IG 5496 5580 1.55e0 SMART
IGc2 5612 5685 1.82e-6 SMART
low complexity region 5799 5829 N/A INTRINSIC
SH3 5832 5895 1.22e0 SMART
Pfam:RhoGEF 5926 6104 4.5e-21 PFAM
PH 6125 6235 2.74e-11 SMART
IGc2 6255 6323 3.73e-12 SMART
IGc2 6349 6418 1.18e-14 SMART
IGc2 6464 6531 1.7e-6 SMART
S_TKc 6562 6815 1.66e-79 SMART
Blast:STYKc 6843 6935 5e-39 BLAST
low complexity region 6939 6954 N/A INTRINSIC
low complexity region 7013 7029 N/A INTRINSIC
low complexity region 7146 7161 N/A INTRINSIC
low complexity region 7199 7219 N/A INTRINSIC
low complexity region 7499 7514 N/A INTRINSIC
IGc2 7538 7606 6.3e-10 SMART
FN3 7620 7698 9.33e-2 SMART
STYKc 7736 7988 8.55e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052872
AA Change: R758G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049737
Gene: ENSMUSG00000061462
AA Change: R758G

IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 809 875 4.49e-6 SMART
IGc2 901 967 2.54e-5 SMART
IGc2 993 1059 2.54e-5 SMART
IGc2 1085 1151 4.49e-6 SMART
IGc2 1177 1243 7.82e-6 SMART
IGc2 1269 1335 5.16e-6 SMART
IGc2 1361 1427 1.93e-5 SMART
IGc2 1453 1519 1.93e-5 SMART
IGc2 1545 1611 1.93e-5 SMART
IGc2 1637 1703 1.93e-5 SMART
IGc2 1729 1795 1.93e-5 SMART
IGc2 1821 1887 1.93e-5 SMART
IGc2 1913 1979 7.94e-7 SMART
IGc2 2005 2071 6.35e-6 SMART
IG 2091 2171 5.37e-4 SMART
IG 2181 2260 9.93e-8 SMART
IG 2271 2350 2.48e-8 SMART
IG 2360 2439 3.89e-1 SMART
IG 2449 2528 1.92e0 SMART
IG 2538 2616 6.45e-7 SMART
IG 2661 2740 1.22e-7 SMART
IGc2 2846 2912 9.93e-8 SMART
low complexity region 2914 2925 N/A INTRINSIC
IG 2929 3008 2.44e0 SMART
IGc2 3024 3090 2.1e-6 SMART
IG 3107 3188 2.86e0 SMART
IGc2 3204 3270 8.38e-6 SMART
IG 3287 3366 1.2e-6 SMART
IG 3376 3457 1.42e-3 SMART
IGc2 3473 3539 3.85e-5 SMART
IGc2 3562 3628 3.13e-5 SMART
IGc2 3651 3716 3.3e-4 SMART
IGc2 3739 3804 5.84e-5 SMART
IGc2 3827 3892 1.29e-6 SMART
IG_like 3915 3980 3.16e-1 SMART
IGc2 3988 4053 1.46e-5 SMART
IGc2 4076 4141 1.25e-4 SMART
IGc2 4164 4229 1.56e-5 SMART
IGc2 4252 4317 1.19e-5 SMART
IGc2 4340 4405 1.93e-5 SMART
IGc2 4428 4493 3.91e-6 SMART
IG 4510 4588 1.85e-7 SMART
IG 4598 4676 1.03e-5 SMART
IGc2 4692 4757 5.08e-5 SMART
IGc2 4780 4846 5.08e-5 SMART
IGc2 4869 4935 1.11e-5 SMART
IGc2 4958 5026 6.71e-5 SMART
IG 5043 5125 2.06e-5 SMART
IG 5135 5216 5.01e-4 SMART
IG 5225 5307 1.04e-1 SMART
IG 5317 5399 9.12e-7 SMART
FN3 5402 5484 2.44e-14 SMART
IG 5511 5593 3.68e-2 SMART
IQ 5753 5775 3.65e-4 SMART
IGc2 5792 5860 8.72e-4 SMART
low complexity region 5868 5884 N/A INTRINSIC
low complexity region 5885 5901 N/A INTRINSIC
low complexity region 5904 5927 N/A INTRINSIC
IGc2 6022 6090 3.25e-12 SMART
low complexity region 6103 6119 N/A INTRINSIC
IG 6149 6233 1.55e0 SMART
IGc2 6265 6338 1.82e-6 SMART
low complexity region 6452 6482 N/A INTRINSIC
SH3 6485 6548 1.22e0 SMART
Pfam:RhoGEF 6579 6757 2.1e-21 PFAM
PH 6778 6888 2.74e-11 SMART
IGc2 6908 6976 3.73e-12 SMART
IGc2 7002 7071 1.18e-14 SMART
low complexity region 7112 7126 N/A INTRINSIC
low complexity region 7127 7154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219084
AA Change: R758G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 800 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein is one of three giant sacromeric signaling proteins that includes titin and nebulin. It may have a role in the organization of myofibrils during assembly and also may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been described although the full-length nature is not known for all splicing variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit centrally localized nuclei in muscle fibers and mild myopathy in aged mice. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
F2rl2 A T 13: 95,700,953 T169S probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in Obscn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Obscn APN 11 59002057 missense probably benign 0.01
IGL00417:Obscn APN 11 59006788 missense unknown
IGL01018:Obscn APN 11 59128069 missense probably damaging 0.99
IGL01083:Obscn APN 11 59036093 missense probably damaging 0.99
IGL01109:Obscn APN 11 59133762 missense probably damaging 1.00
IGL01139:Obscn APN 11 59078352 missense probably damaging 1.00
IGL01361:Obscn APN 11 59028889 missense probably damaging 0.99
IGL01370:Obscn APN 11 58995563 critical splice acceptor site probably null
IGL01409:Obscn APN 11 59031058 missense probably damaging 1.00
IGL01432:Obscn APN 11 59033757 missense probably benign 0.27
IGL01527:Obscn APN 11 59064417 missense possibly damaging 0.83
IGL01543:Obscn APN 11 59042117 missense probably benign 0.01
IGL01578:Obscn APN 11 58999680 missense unknown
IGL01603:Obscn APN 11 59037805 missense probably damaging 1.00
IGL01750:Obscn APN 11 59031639 missense probably damaging 1.00
IGL01765:Obscn APN 11 59115784 missense possibly damaging 0.58
IGL01805:Obscn APN 11 59132596 missense probably damaging 0.99
IGL01816:Obscn APN 11 58995779 splice site probably benign
IGL01885:Obscn APN 11 59074968 missense possibly damaging 0.60
IGL01911:Obscn APN 11 59008595 nonsense probably null
IGL01963:Obscn APN 11 59020541 missense probably benign 0.16
IGL02012:Obscn APN 11 59076507 missense probably benign 0.03
IGL02096:Obscn APN 11 59080704 missense probably damaging 0.98
IGL02125:Obscn APN 11 59093326 missense possibly damaging 0.95
IGL02125:Obscn APN 11 59022362 missense probably damaging 1.00
IGL02203:Obscn APN 11 59082308 missense probably damaging 1.00
IGL02232:Obscn APN 11 59038978 missense probably damaging 0.97
IGL02262:Obscn APN 11 59028533 missense possibly damaging 0.88
IGL02304:Obscn APN 11 59076622 missense probably damaging 1.00
IGL02306:Obscn APN 11 58999671 missense unknown
IGL02323:Obscn APN 11 59008522 missense possibly damaging 0.51
IGL02341:Obscn APN 11 59135825 missense probably benign 0.09
IGL02342:Obscn APN 11 59001088 missense probably benign 0.00
IGL02352:Obscn APN 11 59001027 missense probably benign 0.10
IGL02397:Obscn APN 11 59076899 missense possibly damaging 0.67
IGL02405:Obscn APN 11 59132602 missense probably damaging 0.96
IGL02427:Obscn APN 11 59067162 missense probably damaging 1.00
IGL02479:Obscn APN 11 59056227 splice site probably benign
IGL02512:Obscn APN 11 59028517 missense probably damaging 1.00
IGL02566:Obscn APN 11 59068147 missense probably damaging 1.00
IGL02613:Obscn APN 11 59002132 missense probably benign 0.03
IGL02634:Obscn APN 11 59054785 missense probably damaging 1.00
IGL02680:Obscn APN 11 59000020 missense unknown
IGL02715:Obscn APN 11 59080311 missense probably benign 0.25
IGL02718:Obscn APN 11 59077858 missense probably damaging 1.00
IGL02723:Obscn APN 11 59124620 missense probably benign 0.17
IGL02735:Obscn APN 11 59093349 missense probably damaging 1.00
IGL02951:Obscn APN 11 58994513 splice site probably benign
IGL03004:Obscn APN 11 59028587 missense probably damaging 1.00
IGL03078:Obscn APN 11 59078798 splice site probably null
IGL03114:Obscn APN 11 59000539 missense unknown
IGL03125:Obscn APN 11 59061648 missense probably damaging 1.00
IGL03150:Obscn APN 11 59051723 missense probably damaging 1.00
IGL03156:Obscn APN 11 59054896 missense probably damaging 1.00
IGL03169:Obscn APN 11 59073296 missense probably damaging 1.00
IGL03297:Obscn APN 11 59060886 missense possibly damaging 0.83
IGL03326:Obscn APN 11 59032902 missense probably damaging 1.00
IGL03345:Obscn APN 11 58995482 unclassified probably benign
IGL03348:Obscn APN 11 59050362 missense probably damaging 1.00
IGL03355:Obscn APN 11 59037792 missense probably damaging 1.00
IGL03377:Obscn APN 11 58999873 missense probably damaging 1.00
IGL03396:Obscn APN 11 59073578 missense probably benign 0.12
IGL03405:Obscn APN 11 59000124 missense unknown
Bull UTSW 11 59032918 missense possibly damaging 0.85
ducking UTSW 11 59080969 unclassified probably benign
Goose UTSW 11 59050480 missense probably benign 0.23
Obscurity UTSW 11 58994700 nonsense probably null
Tallow UTSW 11 59076993 missense possibly damaging 0.95
IGL02802:Obscn UTSW 11 59000484 missense unknown
N/A - 535:Obscn UTSW 11 59000308 missense possibly damaging 0.67
PIT4131001:Obscn UTSW 11 59067064 critical splice donor site probably null
PIT4453001:Obscn UTSW 11 59060976 missense probably damaging 1.00
PIT4453001:Obscn UTSW 11 59069834 missense possibly damaging 0.76
PIT4504001:Obscn UTSW 11 59133122 missense probably damaging 1.00
PIT4651001:Obscn UTSW 11 59041681 missense probably damaging 0.99
R0033:Obscn UTSW 11 58994746 unclassified probably benign
R0041:Obscn UTSW 11 59043977 missense probably damaging 1.00
R0042:Obscn UTSW 11 59052585 missense probably damaging 1.00
R0064:Obscn UTSW 11 59027466 missense probably damaging 1.00
R0064:Obscn UTSW 11 59027466 missense probably damaging 1.00
R0071:Obscn UTSW 11 59064201 missense possibly damaging 0.85
R0077:Obscn UTSW 11 59051521 splice site probably benign
R0083:Obscn UTSW 11 59022374 missense probably damaging 1.00
R0089:Obscn UTSW 11 59000062 missense unknown
R0092:Obscn UTSW 11 59051247 missense possibly damaging 0.96
R0103:Obscn UTSW 11 59062696 nonsense probably null
R0103:Obscn UTSW 11 59062696 nonsense probably null
R0108:Obscn UTSW 11 59022374 missense probably damaging 1.00
R0152:Obscn UTSW 11 59052576 missense probably benign 0.06
R0268:Obscn UTSW 11 59067272 missense possibly damaging 0.78
R0271:Obscn UTSW 11 59056742 intron probably benign
R0281:Obscn UTSW 11 59038615 missense probably damaging 1.00
R0329:Obscn UTSW 11 59040441 missense probably damaging 1.00
R0329:Obscn UTSW 11 59052506 missense probably damaging 1.00
R0360:Obscn UTSW 11 59128281 missense probably benign 0.22
R0364:Obscn UTSW 11 59128281 missense probably benign 0.22
R0382:Obscn UTSW 11 59040306 missense probably damaging 1.00
R0386:Obscn UTSW 11 59136339 missense probably damaging 1.00
R0403:Obscn UTSW 11 59076540 missense probably damaging 1.00
R0413:Obscn UTSW 11 59002997 missense probably benign 0.03
R0437:Obscn UTSW 11 58995088 unclassified probably benign
R0442:Obscn UTSW 11 59002174 splice site probably benign
R0445:Obscn UTSW 11 58999335 missense unknown
R0446:Obscn UTSW 11 58995412 unclassified probably benign
R0454:Obscn UTSW 11 58999623 missense unknown
R0463:Obscn UTSW 11 59061530 missense probably benign 0.07
R0479:Obscn UTSW 11 59112707 missense probably damaging 1.00
R0480:Obscn UTSW 11 59133946 nonsense probably null
R0504:Obscn UTSW 11 59008507 critical splice donor site probably null
R0507:Obscn UTSW 11 59029341 missense probably damaging 1.00
R0513:Obscn UTSW 11 59061522 missense possibly damaging 0.81
R0541:Obscn UTSW 11 59081984 missense probably damaging 1.00
R0551:Obscn UTSW 11 59107862 nonsense probably null
R0573:Obscn UTSW 11 59036079 missense probably damaging 1.00
R0599:Obscn UTSW 11 59073696 missense probably damaging 1.00
R0637:Obscn UTSW 11 59051644 missense probably damaging 1.00
R0637:Obscn UTSW 11 59082776 missense probably damaging 0.96
R0653:Obscn UTSW 11 59007708 unclassified probably benign
R0712:Obscn UTSW 11 59049445 missense possibly damaging 0.72
R0715:Obscn UTSW 11 59050480 missense probably benign 0.23
R0729:Obscn UTSW 11 59032709 missense probably damaging 1.00
R0741:Obscn UTSW 11 59063453 frame shift probably null
R0745:Obscn UTSW 11 59082239 missense probably benign 0.14
R0751:Obscn UTSW 11 59081819 missense probably damaging 1.00
R0834:Obscn UTSW 11 59133278 missense probably benign 0.25
R0863:Obscn UTSW 11 58995415 unclassified probably benign
R0909:Obscn UTSW 11 59075064 missense probably damaging 1.00
R0965:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R0980:Obscn UTSW 11 58998061 missense possibly damaging 0.92
R1017:Obscn UTSW 11 58998353 missense unknown
R1103:Obscn UTSW 11 59021483 missense probably damaging 1.00
R1107:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R1128:Obscn UTSW 11 59028943 missense probably null 0.71
R1164:Obscn UTSW 11 59036087 missense possibly damaging 0.65
R1192:Obscn UTSW 11 59067199 missense probably benign 0.33
R1298:Obscn UTSW 11 59054897 missense possibly damaging 0.65
R1331:Obscn UTSW 11 59086928 missense probably benign 0.09
R1333:Obscn UTSW 11 59080317 missense probably damaging 0.99
R1341:Obscn UTSW 11 59029372 splice site probably benign
R1385:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R1386:Obscn UTSW 11 59133853 missense probably damaging 1.00
R1390:Obscn UTSW 11 59093448 missense probably damaging 1.00
R1460:Obscn UTSW 11 59055966 missense probably damaging 1.00
R1495:Obscn UTSW 11 59080160 missense probably damaging 0.99
R1496:Obscn UTSW 11 59031036 missense probably benign 0.01
R1524:Obscn UTSW 11 59115855 missense probably damaging 1.00
R1526:Obscn UTSW 11 59028586 missense probably damaging 1.00
R1537:Obscn UTSW 11 59000749 missense unknown
R1554:Obscn UTSW 11 59003648 missense unknown
R1561:Obscn UTSW 11 59036073 missense probably damaging 1.00
R1589:Obscn UTSW 11 59036075 missense possibly damaging 0.89
R1615:Obscn UTSW 11 59099825 missense probably benign 0.09
R1627:Obscn UTSW 11 59112638 missense probably benign 0.14
R1634:Obscn UTSW 11 59076896 missense probably damaging 1.00
R1636:Obscn UTSW 11 59122637 missense probably damaging 1.00
R1681:Obscn UTSW 11 59103325 missense probably damaging 1.00
R1686:Obscn UTSW 11 59106287 splice site probably benign
R1713:Obscn UTSW 11 59079886 missense probably damaging 1.00
R1730:Obscn UTSW 11 59073633 missense probably damaging 1.00
R1781:Obscn UTSW 11 59106337 missense probably damaging 1.00
R1783:Obscn UTSW 11 59073633 missense probably damaging 1.00
R1793:Obscn UTSW 11 59077780 missense probably damaging 1.00
R1796:Obscn UTSW 11 59029337 missense possibly damaging 0.94
R1801:Obscn UTSW 11 58998321 missense unknown
R1824:Obscn UTSW 11 58994832 unclassified probably benign
R1856:Obscn UTSW 11 59040296 missense probably damaging 1.00
R1866:Obscn UTSW 11 59060915 missense probably benign 0.34
R1878:Obscn UTSW 11 58995553 missense probably damaging 0.99
R1883:Obscn UTSW 11 59078203 missense probably damaging 1.00
R1926:Obscn UTSW 11 59063474 missense possibly damaging 0.69
R1967:Obscn UTSW 11 59135709 nonsense probably null
R1975:Obscn UTSW 11 59067729 missense probably damaging 1.00
R1992:Obscn UTSW 11 58995827 unclassified probably benign
R2021:Obscn UTSW 11 59067174 missense probably benign 0.40
R2066:Obscn UTSW 11 59135732 missense possibly damaging 0.59
R2074:Obscn UTSW 11 59069281 missense probably damaging 0.99
R2074:Obscn UTSW 11 59132652 missense probably damaging 1.00
R2081:Obscn UTSW 11 59034182 missense possibly damaging 0.90
R2083:Obscn UTSW 11 59073631 nonsense probably null
R2086:Obscn UTSW 11 59078256 missense probably damaging 0.99
R2095:Obscn UTSW 11 59093584 splice site probably null
R2098:Obscn UTSW 11 59069991 missense probably damaging 1.00
R2114:Obscn UTSW 11 59131658 missense probably damaging 0.99
R2138:Obscn UTSW 11 59003665 nonsense probably null
R2193:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2194:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2210:Obscn UTSW 11 59068087 missense probably damaging 1.00
R2233:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2234:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2287:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2288:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2351:Obscn UTSW 11 59112612 missense probably damaging 0.99
R2376:Obscn UTSW 11 59069124 missense probably damaging 1.00
R2384:Obscn UTSW 11 59042837 critical splice donor site probably null
R2401:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2402:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2403:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2424:Obscn UTSW 11 58994451 unclassified probably benign
R2433:Obscn UTSW 11 59039086 unclassified probably null
R2445:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2446:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2447:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2449:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2483:Obscn UTSW 11 59080146 missense probably damaging 1.00
R2484:Obscn UTSW 11 59007540 unclassified probably benign
R2496:Obscn UTSW 11 59103442 missense probably damaging 1.00
R2510:Obscn UTSW 11 59042314 splice site probably benign
R2851:Obscn UTSW 11 59030018 critical splice donor site probably null
R2878:Obscn UTSW 11 59056188 missense possibly damaging 0.94
R2879:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2885:Obscn UTSW 11 59086748 missense probably damaging 1.00
R2885:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2886:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R2985:Obscn UTSW 11 59133089 missense probably damaging 1.00
R3013:Obscn UTSW 11 59060918 missense probably damaging 1.00
R3118:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3236:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3237:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3432:Obscn UTSW 11 59031177 missense probably damaging 1.00
R3694:Obscn UTSW 11 59078395 missense probably damaging 1.00
R3716:Obscn UTSW 11 59082661 missense probably damaging 1.00
R3717:Obscn UTSW 11 59082661 missense probably damaging 1.00
R3743:Obscn UTSW 11 59079085 missense probably damaging 0.99
R3760:Obscn UTSW 11 59028580 missense probably damaging 1.00
R3795:Obscn UTSW 11 59031841 missense probably damaging 1.00
R3857:Obscn UTSW 11 59080969 unclassified probably benign
R3858:Obscn UTSW 11 59080969 unclassified probably benign
R3862:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3863:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3864:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3881:Obscn UTSW 11 59056949 missense probably damaging 1.00
R3890:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3903:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3923:Obscn UTSW 11 59060928 missense possibly damaging 0.96
R3944:Obscn UTSW 11 59132547 missense probably damaging 1.00
R3947:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3948:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R3955:Obscn UTSW 11 59036768 missense probably damaging 1.00
R3970:Obscn UTSW 11 59051662 missense probably damaging 1.00
R3971:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4001:Obscn UTSW 11 59134569 missense probably damaging 1.00
R4005:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4017:Obscn UTSW 11 59132622 missense probably damaging 1.00
R4028:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4029:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4041:Obscn UTSW 11 59051531 nonsense probably null
R4061:Obscn UTSW 11 59008532 missense probably damaging 1.00
R4062:Obscn UTSW 11 59082710 missense probably damaging 0.99
R4072:Obscn UTSW 11 58997183 missense unknown
R4078:Obscn UTSW 11 59038363 missense probably benign 0.41
R4079:Obscn UTSW 11 59038363 missense probably benign 0.41
R4092:Obscn UTSW 11 59056060 missense probably benign 0.12
R4106:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4108:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4403:Obscn UTSW 11 59069093 missense possibly damaging 0.95
R4477:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4478:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4480:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4489:Obscn UTSW 11 59031591 missense possibly damaging 0.74
R4531:Obscn UTSW 11 59007874 unclassified probably benign
R4551:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4552:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4553:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4558:Obscn UTSW 11 59131646 missense possibly damaging 0.90
R4570:Obscn UTSW 11 59006828 splice site probably null
R4575:Obscn UTSW 11 59122772 missense probably damaging 0.99
R4593:Obscn UTSW 11 59133249 missense probably damaging 1.00
R4604:Obscn UTSW 11 59080205 missense probably damaging 1.00
R4604:Obscn UTSW 11 59122746 missense probably damaging 0.96
R4625:Obscn UTSW 11 59067258 missense probably damaging 1.00
R4646:Obscn UTSW 11 59124570 nonsense probably null
R4651:Obscn UTSW 11 59038877 missense probably damaging 1.00
R4652:Obscn UTSW 11 59038877 missense probably damaging 1.00
R4657:Obscn UTSW 11 59042290 missense probably damaging 1.00
R4658:Obscn UTSW 11 59054288 nonsense probably null
R4662:Obscn UTSW 11 58999596 missense unknown
R4665:Obscn UTSW 11 59124752 missense probably damaging 1.00
R4718:Obscn UTSW 11 59021954 missense probably damaging 1.00
R4736:Obscn UTSW 11 59063536 missense probably damaging 1.00
R4746:Obscn UTSW 11 59079808 critical splice donor site probably null
R4754:Obscn UTSW 11 59036043 missense possibly damaging 0.81
R4758:Obscn UTSW 11 59003363 missense unknown
R4758:Obscn UTSW 11 59135917 missense probably damaging 0.98
R4766:Obscn UTSW 11 59012742 missense probably damaging 1.00
R4798:Obscn UTSW 11 59069859 missense probably damaging 0.99
R4810:Obscn UTSW 11 59031591 missense possibly damaging 0.74
R4819:Obscn UTSW 11 59038848 missense probably damaging 0.97
R4821:Obscn UTSW 11 59006826 splice site probably benign
R4821:Obscn UTSW 11 59040467 missense probably damaging 1.00
R4822:Obscn UTSW 11 59022333 missense probably benign 0.11
R4828:Obscn UTSW 11 59086670 missense possibly damaging 0.93
R4829:Obscn UTSW 11 59054246 missense probably null 0.53
R4830:Obscn UTSW 11 59067607 missense probably damaging 1.00
R4859:Obscn UTSW 11 59082023 missense possibly damaging 0.89
R4870:Obscn UTSW 11 59136206 missense probably damaging 1.00
R4909:Obscn UTSW 11 59061465 missense possibly damaging 0.52
R4955:Obscn UTSW 11 59069172 missense probably benign 0.31
R4973:Obscn UTSW 11 59132466 missense probably damaging 1.00
R4993:Obscn UTSW 11 59124761 missense possibly damaging 0.48
R5034:Obscn UTSW 11 59061676 nonsense probably null
R5054:Obscn UTSW 11 59073617 missense probably damaging 1.00
R5077:Obscn UTSW 11 59044057 missense probably damaging 0.98
R5126:Obscn UTSW 11 59077063 missense probably damaging 1.00
R5135:Obscn UTSW 11 59129653 missense probably damaging 1.00
R5161:Obscn UTSW 11 59028604 missense probably damaging 1.00
R5161:Obscn UTSW 11 59064310 missense possibly damaging 0.60
R5195:Obscn UTSW 11 59060850 missense possibly damaging 0.78
R5222:Obscn UTSW 11 59044145 missense possibly damaging 0.80
R5260:Obscn UTSW 11 59003369 missense probably damaging 1.00
R5301:Obscn UTSW 11 59135408 missense probably damaging 1.00
R5305:Obscn UTSW 11 59012715 missense possibly damaging 0.83
R5323:Obscn UTSW 11 58996877 missense probably benign
R5333:Obscn UTSW 11 59062692 missense probably damaging 1.00
R5366:Obscn UTSW 11 59080260 missense probably damaging 1.00
R5368:Obscn UTSW 11 59069026 critical splice donor site probably null
R5408:Obscn UTSW 11 59051611 missense probably damaging 1.00
R5439:Obscn UTSW 11 59000128 nonsense probably null
R5536:Obscn UTSW 11 59107871 missense probably damaging 1.00
R5561:Obscn UTSW 11 59036093 missense probably damaging 0.99
R5573:Obscn UTSW 11 59034705 missense possibly damaging 0.94
R5582:Obscn UTSW 11 59099976 splice site probably null
R5586:Obscn UTSW 11 59001468 nonsense probably null
R5607:Obscn UTSW 11 59122848 missense probably benign 0.22
R5700:Obscn UTSW 11 59133194 missense probably benign 0.37
R5706:Obscn UTSW 11 59076256 missense probably damaging 1.00
R5718:Obscn UTSW 11 59036808 missense probably damaging 1.00
R5771:Obscn UTSW 11 59000707 missense unknown
R5772:Obscn UTSW 11 59056144 missense probably damaging 0.99
R5786:Obscn UTSW 11 59032691 missense probably damaging 1.00
R5807:Obscn UTSW 11 59079650 missense probably damaging 1.00
R5815:Obscn UTSW 11 59082189 splice site probably null
R5835:Obscn UTSW 11 59002081 missense probably benign 0.03
R5835:Obscn UTSW 11 59042127 missense probably damaging 1.00
R5846:Obscn UTSW 11 59038609 missense probably damaging 1.00
R5851:Obscn UTSW 11 58994700 nonsense probably null
R5933:Obscn UTSW 11 58998505 missense unknown
R5935:Obscn UTSW 11 59006813 missense unknown
R5974:Obscn UTSW 11 59076547 missense probably damaging 1.00
R5975:Obscn UTSW 11 59122619 critical splice donor site probably null
R6014:Obscn UTSW 11 59038864 missense probably damaging 1.00
R6026:Obscn UTSW 11 59067090 missense probably damaging 0.98
R6082:Obscn UTSW 11 58999567 missense unknown
R6124:Obscn UTSW 11 59079044 missense probably benign 0.45
R6130:Obscn UTSW 11 59077945 missense possibly damaging 0.90
R6160:Obscn UTSW 11 59051785 missense probably damaging 1.00
R6169:Obscn UTSW 11 59000499 missense unknown
R6177:Obscn UTSW 11 59032664 missense probably damaging 1.00
R6189:Obscn UTSW 11 59069934 missense probably benign 0.00
R6192:Obscn UTSW 11 58998038 missense unknown
R6195:Obscn UTSW 11 58997207 missense probably damaging 0.98
R6208:Obscn UTSW 11 59067648 missense possibly damaging 0.81
R6232:Obscn UTSW 11 59052511 nonsense probably null
R6233:Obscn UTSW 11 58997207 missense probably damaging 0.98
R6273:Obscn UTSW 11 59076993 missense possibly damaging 0.95
R6280:Obscn UTSW 11 59063683 missense possibly damaging 0.82
R6317:Obscn UTSW 11 59069895 missense probably damaging 1.00
R6345:Obscn UTSW 11 59053696 missense probably damaging 0.99
R6378:Obscn UTSW 11 59073746 missense probably damaging 1.00
R6382:Obscn UTSW 11 58999413 missense unknown
R6382:Obscn UTSW 11 59042208 missense probably damaging 0.99
R6415:Obscn UTSW 11 59035130 missense probably damaging 0.99
R6433:Obscn UTSW 11 59051558 missense probably benign 0.14
R6457:Obscn UTSW 11 59080771 missense probably damaging 0.99
R6508:Obscn UTSW 11 59054147 splice site probably null
R6611:Obscn UTSW 11 59064230 synonymous probably null
R6614:Obscn UTSW 11 59012801 missense probably benign 0.01
R6645:Obscn UTSW 11 59085262 missense probably damaging 0.97
R6646:Obscn UTSW 11 59082718 missense possibly damaging 0.72
R6659:Obscn UTSW 11 59039009 missense probably damaging 1.00
R6723:Obscn UTSW 11 59054998 missense probably damaging 0.99
R6733:Obscn UTSW 11 59028595 missense probably damaging 0.99
R6755:Obscn UTSW 11 59103326 missense probably damaging 1.00
R6770:Obscn UTSW 11 59044036 missense possibly damaging 0.88
R6820:Obscn UTSW 11 59051193 missense probably damaging 1.00
R6823:Obscn UTSW 11 59067943 critical splice donor site probably null
R6850:Obscn UTSW 11 59002129 missense possibly damaging 0.92
R6850:Obscn UTSW 11 59068124 missense possibly damaging 0.93
R6862:Obscn UTSW 11 58995453 unclassified probably benign
R6884:Obscn UTSW 11 59078302 missense probably damaging 1.00
R6894:Obscn UTSW 11 59132682 missense probably benign 0.43
R6906:Obscn UTSW 11 59032918 missense possibly damaging 0.85
R6944:Obscn UTSW 11 59038930 missense probably damaging 1.00
R6948:Obscn UTSW 11 59106316 missense probably damaging 1.00
R6959:Obscn UTSW 11 59037585 missense probably damaging 1.00
R7000:Obscn UTSW 11 59136038 missense probably damaging 1.00
R7028:Obscn UTSW 11 59079133 missense probably damaging 1.00
R7037:Obscn UTSW 11 59043929 missense probably damaging 1.00
R7037:Obscn UTSW 11 59052604 missense probably damaging 0.98
R7056:Obscn UTSW 11 58996296 unclassified probably benign
R7112:Obscn UTSW 11 59029325 missense
R7121:Obscn UTSW 11 59013252 nonsense probably null
R7123:Obscn UTSW 11 59013651 missense probably benign
R7182:Obscn UTSW 11 59035101 missense probably damaging 0.99
R7199:Obscn UTSW 11 59012846 missense probably benign 0.09
R7209:Obscn UTSW 11 59085107 nonsense probably null
R7235:Obscn UTSW 11 59080840 missense probably damaging 0.98
R7247:Obscn UTSW 11 59103318 nonsense probably null
R7262:Obscn UTSW 11 59115889 missense probably damaging 0.99
R7269:Obscn UTSW 11 59043012 missense probably damaging 0.99
R7270:Obscn UTSW 11 59029486 missense
R7274:Obscn UTSW 11 59133227 missense probably damaging 1.00
R7312:Obscn UTSW 11 59055616 missense probably benign 0.00
R7313:Obscn UTSW 11 59007588 missense unknown
R7360:Obscn UTSW 11 59082359 missense probably damaging 1.00
R7380:Obscn UTSW 11 59056914 missense
R7389:Obscn UTSW 11 59036400 missense probably benign 0.02
R7402:Obscn UTSW 11 58995449 missense unknown
R7417:Obscn UTSW 11 59129577 missense possibly damaging 0.93
R7432:Obscn UTSW 11 59028907 missense
R7456:Obscn UTSW 11 59008558 missense probably benign 0.01
R7459:Obscn UTSW 11 59131657 missense probably benign 0.00
R7463:Obscn UTSW 11 59122860 missense probably benign 0.02
R7478:Obscn UTSW 11 59093416 missense probably damaging 1.00
R7498:Obscn UTSW 11 59082713 missense probably damaging 1.00
R7502:Obscn UTSW 11 58994809 missense unknown
R7509:Obscn UTSW 11 59051629 missense probably benign 0.36
R7516:Obscn UTSW 11 59124590 nonsense probably null
R7545:Obscn UTSW 11 59038899 missense probably damaging 1.00
R7549:Obscn UTSW 11 59042838 critical splice donor site probably null
R7582:Obscn UTSW 11 59061427 nonsense probably null
R7607:Obscn UTSW 11 58998265 missense unknown
R7609:Obscn UTSW 11 59000299 missense unknown
R7647:Obscn UTSW 11 58997287 critical splice acceptor site probably null
R7650:Obscn UTSW 11 59060994 missense probably benign 0.01
R7673:Obscn UTSW 11 59027437 missense
R7743:Obscn UTSW 11 59099777 missense probably damaging 1.00
R7745:Obscn UTSW 11 59060855 missense probably damaging 1.00
R7823:Obscn UTSW 11 59107940 missense probably damaging 1.00
X0010:Obscn UTSW 11 58995553 unclassified probably benign
X0012:Obscn UTSW 11 59006776 missense unknown
X0021:Obscn UTSW 11 59077906 missense probably damaging 0.96
X0058:Obscn UTSW 11 59035968 missense probably damaging 1.00
X0061:Obscn UTSW 11 59077830 missense probably damaging 1.00
X0063:Obscn UTSW 11 59000056 missense unknown
X0067:Obscn UTSW 11 59131801 missense probably benign 0.19
Y4336:Obscn UTSW 11 59131646 missense possibly damaging 0.90
Y4337:Obscn UTSW 11 59131646 missense possibly damaging 0.90
Y4338:Obscn UTSW 11 59131646 missense possibly damaging 0.90
Y5407:Obscn UTSW 11 59021943 missense probably damaging 0.97
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcccttctcttcctcactcc -3'
Posted On2013-11-08