Incidental Mutation 'R0969:F2rl2'
ID83995
Institutional Source Beutler Lab
Gene Symbol F2rl2
Ensembl Gene ENSMUSG00000021675
Gene Namecoagulation factor II (thrombin) receptor-like 2
SynonymsPAR3
MMRRC Submission 039098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0969 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location95696853-95702739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95700953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 169 (T169S)
Ref Sequence ENSEMBL: ENSMUSP00000022182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022182] [ENSMUST00000068603]
PDB Structure
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022182
AA Change: T169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022182
Gene: ENSMUSG00000021675
AA Change: T169S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:7tm_1 110 295 1.7e-32 PFAM
Pfam:7tm_1 297 357 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068603
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protease-activated receptor (PAR) family which is a subfamily of the seven transmembrane G protein-coupled cell surface receptor family. The encoded protein acts as a cofactor in the thrombin-mediated cleavage and activation of the protease-activated receptor family member PAR4. The encoded protein plays an essential role in hemostasis and thrombosis. Alternate splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in prolonged bleeding times, delayed and reduced thrombin responses in platelets, and protection against thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,080 probably null Het
Afg1l T C 10: 42,318,621 T392A probably damaging Het
Ccdc66 A G 14: 27,497,362 S146P probably damaging Het
Ccl20 T A 1: 83,117,917 probably benign Het
Cd2 T A 3: 101,276,055 I313F probably benign Het
Cep350 A T 1: 155,940,826 D374E possibly damaging Het
Cep85l T C 10: 53,281,496 K602E probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dhx8 T C 11: 101,739,700 probably benign Het
Epha3 A T 16: 63,566,636 L878Q probably damaging Het
Gpx3 T C 11: 54,909,026 probably benign Het
Ipo5 T A 14: 120,944,525 V1010D possibly damaging Het
Nipbl A T 15: 8,292,228 L2647Q probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr73 T C 2: 88,034,248 D297G probably damaging Het
Pcnt T C 10: 76,427,951 E393G probably damaging Het
Pibf1 C A 14: 99,196,386 Q590K probably benign Het
Pkd1l1 T C 11: 8,936,898 D367G probably damaging Het
Pnpla7 T C 2: 25,050,953 Y1106H probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco5a1 C T 1: 12,989,892 A202T probably damaging Het
Slco6c1 A C 1: 97,119,960 I206R probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Srek1 G A 13: 103,752,503 probably benign Het
St8sia6 T A 2: 13,696,869 R112S probably benign Het
Suclg1 T A 6: 73,271,116 H273Q probably benign Het
Taf2 T A 15: 55,031,157 probably null Het
Tctn1 A G 5: 122,241,777 V566A probably benign Het
Trpm4 A G 7: 45,327,907 probably benign Het
Trpv3 C T 11: 73,278,938 Q112* probably null Het
Ttll8 T C 15: 88,933,935 Y179C probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Upk1b A G 16: 38,787,299 probably benign Het
Zfp961 T G 8: 71,968,295 H217Q probably damaging Het
Other mutations in F2rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:F2rl2 APN 13 95701328 missense probably benign 0.00
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R1183:F2rl2 UTSW 13 95701113 missense probably damaging 0.96
R1482:F2rl2 UTSW 13 95701539 missense probably benign 0.02
R1753:F2rl2 UTSW 13 95701461 missense probably benign 0.16
R2428:F2rl2 UTSW 13 95697077 missense possibly damaging 0.75
R3151:F2rl2 UTSW 13 95701130 missense probably benign 0.00
R4678:F2rl2 UTSW 13 95700632 missense probably benign 0.10
R5153:F2rl2 UTSW 13 95697112 missense probably benign 0.00
R5229:F2rl2 UTSW 13 95700687 missense possibly damaging 0.93
R5635:F2rl2 UTSW 13 95700782 missense possibly damaging 0.88
R6041:F2rl2 UTSW 13 95701109 missense probably benign 0.01
R6146:F2rl2 UTSW 13 95700641 missense probably benign 0.08
R6974:F2rl2 UTSW 13 95700530 missense probably damaging 0.97
R6993:F2rl2 UTSW 13 95701134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATCGTGACCCTGTGGAAACTC -3'
(R):5'- AGCCCAGCCATATCCGATCCTTTG -3'

Sequencing Primer
(F):5'- GTCATCTTTCACACCAACCTGG -3'
(R):5'- TCCTGCTTCAGGATGACAAAG -3'
Posted On2013-11-08