Incidental Mutation 'R0970:Ppm1f'
ID 84038
Institutional Source Beutler Lab
Gene Symbol Ppm1f
Ensembl Gene ENSMUSG00000026181
Gene Name protein phosphatase 1F (PP2C domain containing)
Synonyms 4933427B07Rik, 1110021B16Rik
MMRRC Submission 039099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0970 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 16896469-16927364 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 16903593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027373] [ENSMUST00000232247]
AlphaFold Q8CGA0
Predicted Effect probably null
Transcript: ENSMUST00000027373
SMART Domains Protein: ENSMUSP00000027373
Gene: ENSMUSG00000026181

DomainStartEndE-ValueType
Blast:PP2Cc 25 97 1e-16 BLAST
low complexity region 99 110 N/A INTRINSIC
PP2Cc 141 408 3.14e-79 SMART
PP2C_SIG 168 410 5.13e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145978
Predicted Effect probably benign
Transcript: ENSMUST00000232247
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are not detected at weaning. Mice heterozygous for a targeted mutation display hyperactivity and an increase in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,767,571 S307P probably damaging Het
Amdhd2 C T 17: 24,156,570 probably null Het
Ano1 A T 7: 144,595,571 M851K probably benign Het
Arid3b A T 9: 57,833,551 probably benign Het
Arpp21 A G 9: 112,136,448 probably benign Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
C87436 G A 6: 86,447,328 V281M probably damaging Het
Cep70 A G 9: 99,275,599 K184E possibly damaging Het
Clcn7 T C 17: 25,151,234 probably null Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col4a2 A G 8: 11,415,438 T383A probably benign Het
Commd5 A T 15: 76,900,685 probably null Het
Cyp4b1 G A 4: 115,635,636 A292V probably benign Het
Dthd1 T C 5: 62,887,981 L696P probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eepd1 A G 9: 25,603,426 R510G probably damaging Het
Eno3 T C 11: 70,660,802 I196T probably damaging Het
Eva1a A G 6: 82,092,103 E137G probably damaging Het
Gapvd1 T A 2: 34,730,613 probably null Het
Ggnbp2 T C 11: 84,862,312 M34V possibly damaging Het
Gpihbp1 G A 15: 75,597,946 S170N probably benign Het
Kdm3b T C 18: 34,809,039 S528P probably damaging Het
Lrrk2 A T 15: 91,729,169 Q832L probably benign Het
Nav2 C A 7: 49,584,153 P1861Q probably damaging Het
Olfr669 A C 7: 104,939,077 M184L probably benign Het
Piezo1 A T 8: 122,486,810 I1782N possibly damaging Het
Pikfyve T A 1: 65,265,824 S1757T probably damaging Het
Plxnb1 G T 9: 109,103,263 W523C probably damaging Het
Pmm2 G T 16: 8,642,776 L31F probably damaging Het
Prss16 T C 13: 22,005,117 Y34C probably damaging Het
Slc10a2 C G 8: 5,105,115 E23D probably benign Het
Smc5 T A 19: 23,238,998 I489F probably damaging Het
Snx2 T C 18: 53,210,690 probably benign Het
Stradb C T 1: 58,977,060 L3F possibly damaging Het
Tnxb C G 17: 34,698,943 P2277A possibly damaging Het
Tpm2 T A 4: 43,515,968 I270F probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Urb1 A T 16: 90,769,447 L1484Q possibly damaging Het
Xylt1 G A 7: 117,634,736 V497I probably damaging Het
Other mutations in Ppm1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ppm1f APN 16 16923913 missense probably benign 0.03
IGL00495:Ppm1f APN 16 16910971 missense possibly damaging 0.87
IGL01024:Ppm1f APN 16 16923769 missense probably benign 0.05
IGL02076:Ppm1f APN 16 16914171 missense possibly damaging 0.93
IGL02332:Ppm1f APN 16 16914087 missense possibly damaging 0.72
IGL02422:Ppm1f APN 16 16917716 missense probably damaging 0.99
IGL02936:Ppm1f APN 16 16915236 missense probably damaging 1.00
IGL03118:Ppm1f APN 16 16914078 missense probably null 0.03
R0348:Ppm1f UTSW 16 16903390 start codon destroyed probably null 0.71
R0621:Ppm1f UTSW 16 16915308 missense probably benign 0.00
R1785:Ppm1f UTSW 16 16910970 missense probably benign
R1812:Ppm1f UTSW 16 16917787 missense probably damaging 1.00
R1988:Ppm1f UTSW 16 16923666 missense probably damaging 0.98
R2080:Ppm1f UTSW 16 16923880 missense possibly damaging 0.50
R3687:Ppm1f UTSW 16 16923883 missense probably damaging 0.96
R5456:Ppm1f UTSW 16 16923746 missense probably damaging 0.99
R7162:Ppm1f UTSW 16 16914193 missense probably damaging 1.00
R7290:Ppm1f UTSW 16 16910955 missense probably benign
R7391:Ppm1f UTSW 16 16914234 missense probably benign 0.04
R8492:Ppm1f UTSW 16 16915178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCAGGACACATGTACTCCACG -3'
(R):5'- GCATTTACTCAGGAAGAGACGGCAC -3'

Sequencing Primer
(F):5'- GACTTGACTGGAGACTGTCTCAC -3'
(R):5'- CGGCACTGGATGACAGG -3'
Posted On 2013-11-08