Incidental Mutation 'R0966:Wdr3'
ID84048
Institutional Source Beutler Lab
Gene Symbol Wdr3
Ensembl Gene ENSMUSG00000033285
Gene NameWD repeat domain 3
SynonymsD030020G18Rik
MMRRC Submission 039095-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R0966 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100138180-100162407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100161069 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 41 (V41E)
Ref Sequence ENSEMBL: ENSMUSP00000135731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029459] [ENSMUST00000052120] [ENSMUST00000106997] [ENSMUST00000125059] [ENSMUST00000197602]
Predicted Effect probably benign
Transcript: ENSMUST00000029459
SMART Domains Protein: ENSMUSP00000029459
Gene: ENSMUSG00000027865

DomainStartEndE-ValueType
Pfam:Macro 72 185 1.3e-30 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000052120
AA Change: V41E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060613
Gene: ENSMUSG00000033285
AA Change: V41E

DomainStartEndE-ValueType
Blast:WD40 12 51 3e-16 BLAST
WD40 54 93 3.14e-6 SMART
WD40 96 135 1.04e-6 SMART
WD40 138 177 1.15e-4 SMART
WD40 180 219 4.24e-3 SMART
low complexity region 225 239 N/A INTRINSIC
Blast:WD40 267 307 3e-18 BLAST
low complexity region 316 331 N/A INTRINSIC
WD40 403 441 8.49e-3 SMART
WD40 444 481 1.71e1 SMART
WD40 484 523 2.1e-7 SMART
WD40 538 576 1.2e-2 SMART
WD40 579 618 2.45e-8 SMART
WD40 621 660 5.47e-6 SMART
WD40 663 702 1.03e-10 SMART
low complexity region 711 724 N/A INTRINSIC
Pfam:Utp12 803 906 6.4e-25 PFAM
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106997
SMART Domains Protein: ENSMUSP00000102610
Gene: ENSMUSG00000027865

DomainStartEndE-ValueType
Pfam:Macro 72 185 4.4e-32 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125059
AA Change: V41E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135731
Gene: ENSMUSG00000033285
AA Change: V41E

DomainStartEndE-ValueType
Blast:WD40 12 51 2e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146989
SMART Domains Protein: ENSMUSP00000134945
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150223
Predicted Effect probably damaging
Transcript: ENSMUST00000197602
AA Change: V41E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143010
Gene: ENSMUSG00000033285
AA Change: V41E

DomainStartEndE-ValueType
Blast:WD40 12 51 1e-18 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing 10 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, which usually include a trp-asp at the C-terminal end. Proteins belonging to the WD repeat family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T A 16: 88,707,422 R162S probably damaging Het
Arhgef10 T G 8: 14,940,343 S272A probably benign Het
Cd101 A C 3: 101,008,222 S676R probably benign Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Flrt2 T C 12: 95,780,301 V471A possibly damaging Het
Fzd8 A T 18: 9,214,745 E609V probably damaging Het
Gm10110 A C 14: 89,898,119 noncoding transcript Het
Gm5724 A G 6: 141,727,573 F413S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Igf2bp2 C T 16: 22,089,090 R19Q probably damaging Het
Mmp16 C G 4: 18,115,930 N511K probably benign Het
Myo7b T C 18: 31,998,763 H460R probably damaging Het
Olfr68 T A 7: 103,777,449 T299S probably damaging Het
Plekhh1 T C 12: 79,065,730 F594L probably damaging Het
Prkca T A 11: 108,014,284 K209N possibly damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Ugt1a6b G A 1: 88,107,128 V63I probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps36 G A 8: 22,206,817 W131* probably null Het
Other mutations in Wdr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Wdr3 APN 3 100148108 missense probably damaging 1.00
IGL00706:Wdr3 APN 3 100148100 unclassified probably benign
IGL01391:Wdr3 APN 3 100146789 unclassified probably benign
IGL02008:Wdr3 APN 3 100150982 missense probably damaging 0.97
IGL02136:Wdr3 APN 3 100138725 nonsense probably null
IGL02215:Wdr3 APN 3 100146700 critical splice donor site probably null
IGL02505:Wdr3 APN 3 100151974 missense probably benign
IGL03412:Wdr3 APN 3 100151977 missense probably benign 0.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0369:Wdr3 UTSW 3 100156418 nonsense probably null
R0865:Wdr3 UTSW 3 100152796 unclassified probably benign
R1168:Wdr3 UTSW 3 100142219 missense probably benign 0.11
R1612:Wdr3 UTSW 3 100151199 splice site probably benign
R1768:Wdr3 UTSW 3 100153870 missense probably benign
R2060:Wdr3 UTSW 3 100159897 unclassified probably null
R3793:Wdr3 UTSW 3 100151965 missense probably benign 0.02
R3888:Wdr3 UTSW 3 100153906 missense probably benign
R4410:Wdr3 UTSW 3 100140227 missense probably benign
R4596:Wdr3 UTSW 3 100152867 missense possibly damaging 0.95
R4609:Wdr3 UTSW 3 100140200 missense probably damaging 1.00
R4817:Wdr3 UTSW 3 100146545 missense possibly damaging 0.71
R5016:Wdr3 UTSW 3 100141620 intron probably benign
R5024:Wdr3 UTSW 3 100154936 missense probably benign
R5411:Wdr3 UTSW 3 100142984 missense probably damaging 1.00
R5430:Wdr3 UTSW 3 100157327 missense possibly damaging 0.88
R5902:Wdr3 UTSW 3 100144491 unclassified probably benign
R6177:Wdr3 UTSW 3 100161152 missense probably damaging 0.97
R6445:Wdr3 UTSW 3 100156403 missense possibly damaging 0.65
R6516:Wdr3 UTSW 3 100145676 missense probably damaging 1.00
R6624:Wdr3 UTSW 3 100144326 missense probably damaging 1.00
R6747:Wdr3 UTSW 3 100138724 missense probably damaging 1.00
R6813:Wdr3 UTSW 3 100138725 nonsense probably null
R6899:Wdr3 UTSW 3 100149901 missense possibly damaging 0.90
R7024:Wdr3 UTSW 3 100154997 missense probably benign 0.00
R7509:Wdr3 UTSW 3 100151187 missense probably benign 0.03
R8008:Wdr3 UTSW 3 100154936 missense probably benign
R8062:Wdr3 UTSW 3 100142494 missense probably benign
X0012:Wdr3 UTSW 3 100145630 splice site probably null
Z1088:Wdr3 UTSW 3 100144344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAAACTCCTGCTTGGCTGTG -3'
(R):5'- AGATTGCCTTCCCGGTGTCATCAG -3'

Sequencing Primer
(F):5'- GGCTGTGACTTTCAGAACAC -3'
(R):5'- GTGTCATCAGACAGCCCAG -3'
Posted On2013-11-08